Basic Information

Symbol
KCNJ8
RNA class
mRNA
Alias
Potassium Inwardly Rectifying Channel Subfamily J Member 8 Kir6.1 Potassium Channel, Inwardly Rectifying Subfamily J Member 8 ATP-Sensitive Inward Rectifier Potassium Channel 8 Inward Rectifier K(+) Channel Kir6.1 UKATP-1 Potassium Inwardly-Rectifying Channel, Subfamily J, Member 8 Potassium Voltage-Gated Channel Subfamily J Member 8 Inwardly Rectifying Potassium Channel KIR6.1
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Other applications

MANE select

Transcript ID
NM_004982.4
Sequence length
2274.0 nt
GC content
0.4802

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-740.60 kcal/mol
Thermodynamic ensemble
Free energy: -783.88 kcal/mol
Frequency: 0.0000
Diversity: 565.40
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
................(((((.((((((.(............((((((((((..((((((((..((((.((((((((((.((..(((...(((.((......)))))..))))).))))))))......)).))))..)))..)))))....)))))).....))))).))))))))))).(((((((.(((((((((((((((((((..(((((((((..((((((.....(((((.(((((..(((((..(((((((((((...(((((.((((((((((........))...)))))..)))))))))))...(((((((((((....(((((((.........)))))))((..(((....(((((.(((((.(((((........))..(((((((.((((......(((((..(((((.((((((((..((((((((((((.(((.(.(((..(((((.(((((((.((((((..(((((((..(((((((...)))))))..))))))).))))((((((((.((....))))).))))).....)).)))).))).)....))))..)))).))).)))))).))).)))...)))))))).....((((((((((((.((((((.((.((((((((.......)))))))).)).))))))(((((.((((((.....))))))..)))))..((((((......))))))...((((((((((((((.(((((((((......)))))))))...)))).......))))))))))))))))))))))....(((....((((.(((((..((.(((....)))))..)))))..))))....)))....)))))..))))))))).)).)))))))).)).))))))))....)))))...((((((................))))))..)))))))))))((((..((((.((.(((((((..((.(((((......))))).))..............((((((((((.((((((.((((((..((.....))..).)))(((........)))..((((((((.((((((..((((.......))))))))))..........(((.((.(((.(((.......(((.....)))..))).)))...)))))....))))))))))))).))).))))))))))....)))))))))))))...)))).............)))).)))))))))....))))))))))))))))..))))).((((..(...((((.(((((((((.(((((.((((((((((.....((((((((((.........((((((((((..((.......(((((...(((........)))..)))))..........((((((((((((...((((.......))))...))))).)))))))(((((...)))))...((((((.(((.((.(............).))))).))))))(((((....((((.((((((.............))))))..))))..)))))..((((..(((((.((.(((((((.(((.((((....)))))))...(((.(((((((((.....((((...)))).........((((......)))).))))))))).)))....((((((((.((...((((((........(((.....)))((((...((((.((((((.......(((.((..((((.(((((((......(((((.........)))))..........((((((((((((((((((((((.((.......)).)))))......))))))......))))..)))))))..)))))..)).)))))).)))....)))))).))))..))))...(((.(((((((((.....((((((((((....))).))))))).......)).))))))))))))))))...)).)))))))).....(((...))).......))))...))).)).)))))..))))))..)))))))))).....)))))..))))).....)))))))).)).))))).))).))).)))))))...)..)))).(((((...))))).....((..((((.(((((((.......))))))).))))..)).))))...)))))))))))......)))))))))))))))..........(((((((((...(((.((((........)))).))).))))))))).
Thermodynamic Ensemble Prediction
..........(((((((((((.((((((.(..,,........((({(((((((((((((((,((((,((((((.((....)).)))),..||.}))).,).))))),}})),||.||||||,{{..{{.,|.}},}}})))))))),)}...,}))))...,.))})),))))))))))).))))}){.((((({(((((((((((((..(((((((((..((((((.....((({,{(((({..{{(((..,((({{{{|||,.|(((((,{((({{||||,,,,,,{.,,..,))))}..))))))))}}}..{(((((((((((....(((((((,........)))))))||,.{{{....{((((,({{((.{,(((,,,,....}},.(((((((.((((......(((((..{{{||,|(((((((..{(((((((((((.(((.(.(((..(((((.(((((((.((((((..(((((((..,{(((((,..,}))))),.))))))).})))((((({{{.(,....||}},.))))),....}).)))}.))),|...|))))..)))}.))).)))))).))).)),...)))))))}.....{(((((((((({,{(({{{.{{.{{|{((({....,,.))))))}),)),)))))){((((.((((((.....))))))..)))))..{{((((......)))))}..{((((((((((((((.(((((((((......)))))))))...)))).......)))))))))))))))))))))|,,..{{{..,.((((.{{{{{.,||.|{(,,,,||}},..))))),.))))....))).}|,}}})).}))))))))).)))}}})),}}.}}.},,)))}}..,,))))}...((((((................))))))..)))))))))))|(({..((({,{{.(((((((..((.(((((......))))).)).,............{(((((((((.((((((.,{{{{,..(,{,,,,,|..,.}))|||...,},..},,.,((((((((.(((({(,,((,,,,,....})))})))))..|,,....,{{.,((,((({({(...,...{|{...,,)))..,,}.},,...))))),...})))))))}.)))},)).)))))))))}....))))))))))))).,,}))},..,||||||,.,}}}}.})}}})))),...}})))}}})}))))))..))))|{(({(,,,...((((.(((((((((.(((((.((((((((((.....((((,(((((....,{{,.((((((((((..((.......(((((.,,(({.......,)))..))))}{{,.....,}((((((((((((...((((.......)))}...)))))))))))))(((((...)))))...((((((.(((.((.(............).))))).))))))(((((....((((.((((((.............))))))..))))..)))))..((((..(((((.((.((({(({.((,{((((....)))))))...(((.(((((((((.....{(((...,}}}......,,.{{{{,.....}})).))))))))).)))....((((((((.((...((((((....,{{.(((.....))},|||...((((.((((((....,{.{((.,,..((((.(((((((......(((((.........)))))..........((((((((((((((((((((((.((.......)).)))))......)))))),.....})))..)))))))..))))}.,)).))))},.))),}.,)))))).))))..}}},...{(,{(((((((((.....((((((((((....))).))))))).......))}})))))))))))))))...)).)))))))).,,..{{(,..|||,.....,))))...))).)).)))))..))))))..))))))))))..}}})))))..})))).....))))))))},).))))).))).))).)))))))}}})},},))}{||||.,,}}})}.,,..((,.{{({.(((((((.......))))))),}|)}.})).))))...)))))))))))}}..,,))))}))}||}}},,.}}},.....(((((((((...(((.((((........)))).))).))))))))).

Transcripts

ID Sequence Length GC content
AUUAUUUUAACUCUUCUCCUUAGGACACGCAGCCCCCAAUUUGUCCCUC… 2274 nt 0.4802
Summary

Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. Defects in this gene may be a cause of J-wave syndromes and sudden infant death syndrome (SIDS). [provided by RefSeq, May 2012]

Forensic Context

A study in humans demonstrated that the KCNJ8 is a potassium channel gene highly expressed in the pericytes of the corpus cavernosum [Zhao et al. DOI:10.1038/s41467-022-31950-9]. In a separate human autopsy study of sudden cardiac death, the KCNJ8 was identified as a down-regulated ion transport regulator in the left ventricular myocardium of arrhythmic deaths compared to nonarrhythmic deaths [Caudal et al. DOI:10.1016/j.jacep.2024.08.013].