Basic Information

Symbol
KCNJ9
RNA class
mRNA
Alias
Potassium Inwardly Rectifying Channel Subfamily J Member 9 GIRK3 G Protein-Activated Inward Rectifier Potassium Channel 3 Kir3.3 Potassium Channel, Inwardly Rectifying Subfamily J Member 9 Inward Rectifier K(+) Channel Kir3.3 Potassium Inwardly-Rectifying Channel, Subfamily J, Member 9 G Protein-Coupled Inward Rectifier Potassium Channel Potassium Voltage-Gated Channel Subfamily J Member 9 Inwardly Rectifier K+ Channel KIR3.3 GIRK-3
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_004983.3
Sequence length
4202.0 nt
GC content
0.5840

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1734.30 kcal/mol
Thermodynamic ensemble
Free energy: -1799.45 kcal/mol
Frequency: 0.0000
Diversity: 1247.79
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((..((((.(((((((((((((((.(((((..(......)...)))))..))))).(((.((((.((((...)))).)))))))(((((((((((((((.((((.((........)).)))).))))((((((((...((((((((((((((...(((((.((....))...(((((((..((((........))))...)))))))....((((((((....(((((.((((..(((((....(((.((((......)))).)))...))))).))))...)))))......)))))))).))))).((.((((((....)))))).))....)).)))))))).))))))))))))((((((.((((((.(.((((((((((((((......(((.((((((..((.(((((.((((....)))).((((((.((((.((.((((((((((((((((((((((.((((...((((.((((((((((((((..((((.....(((((((........))))))))))).((((((((..((.((.(.(((.(((....))).)))).))......(((.....((((.((.(((((((((((((((......((.((((........))))))..((((((.(.(((......)))).))))))(((((((..((((((.((((....))))(((......))).((((((.(.....).))))))((((((((..(.((.....)).)..))))))))...))))))..)))...))))((((((((((.(((.((((.((((....)))).)))).((((((((((.(((((...))))))))(((((((.((((((.(((...))))))).((((((((((.((...(((..((((((((.((((...))))...))))))((.(((((.((....((.((.((......)).))))....)))))))))...(((((((((((((((((((..((((.....))))..))))))(((((((.((((......))))..))))))).((((((((((((((...((((((.........))))))...))))))))))))))(((.((..((((..((......))..))))..))))).....((((..(((((((..((((((((.(((((((..((((....))))..((((((....)))))).)))))))....(((((((((((..((((((...((((((....)))))).....))).))))))))))))))..)))).)))).))))))).))))...(((((((..(((((((((....))..))))).)).))))))))))))))))))))))))))).))))))))))...((((((.((.((.(((((......))).)))).)).)))))))).)))))))...((((((..(((.((((.(((..((((((.(.....)))))))...............)))))))))))))))))))))))))))))))))))).)))))))))))))..((((((((...((.(((((..(((.....((((....(((((((((((((...((((..........))))...))))..(((((....)))))(((((((((((.((((((((((.......)).)))).)))).)))))).)))))((((((.(.....((......))...).)))))))))))))))..)))).....)))..))))).)).....)))..............(((((((((((.....))))))))).)).)))))(((....(((((((((.((((((((((.................(((((((((((((..(..((((..((((((.(((.......))).))))))......)))).)..))))....((.((((((((((((((((((((.((.((((......((((....(((((....)))).)....))))..(((..((((.((.(...(((((.(((.......((((((.........)))))))))..))))).))))))))))..((((....(((...(((((....(((((.......)))))))))))))..)))))))).)).))))))....))))))).....))))))).)))))))))))(((((..........)))))..............))))).)).)))...)).)))))))....)))...)))).)))).....)))))..))))))))))))))))))))))(((....)))....((((....)))).))))))))...))))..(((((.((((..((...)).)))).))))).(((((((.((((.......(((((((((((.....)))).)))))))......((((((((((((........)))))..(((......))))))))))....))))))))))).)))))))))))).....((((..((((..(((.((((.((.....)).)))).)))))))..)))).)))))))))))).))).)))......))))).))..)))))))))......))))..)))))))))).....((((((.((((((.........((...((((((.(((((((.(..(((((...)))))..).))))))).))))))...))..........))))))))))))).)))))))))))).......((((((.(((((.(((........))).)))))....(((((((....)))))))....((((((.(((..(((.(.....((((((((((((.........((((.......))))(((....)))...((((((((..((((..((((((((((((((........((((((..(((.(((((((...(((((....)))))..))))))))))..........(((....)))...((((((.....((((.(((((((((.(.((..((((...(((((((..(((.(((......((.((((......)))).))..))))))((((((.((((.((((((((.(..((((..(((((.(((((...........(((((.(((((.(((.(((((..(((.(((((..((....((((........)))).....))...)))).).))).))))).)))))))).....((((....)))).)))))))))).))))).....))))..).)))))))).))))))))))..((.((((((.(((.(((((.((((((((((........)))))).....))))..)))).)...)))...)))))))).))).)))).))))((((((..........))))))((((....))))..(((((.(((.((((((.......))))..)).))).))))))).).)))))))))))))))))))......)))))))))))))).))))))......((((((......)))))))))).)))))))).((((((((..(((((((((((((((((.(......)))))))).(((...)))))))))))))(((((((((..............((((..((....))))))......(((((.....))))))))))))))..).))))))).)))))))))))).....).)))...))).))))))(((((.(((((((.....)))))))(((((...)))))...((((((......((((((((((((.((((.((....((((.(((((.(((((.((((.(.......((((((((((....(((((((((((((((..(((.((((.((((.((((.......................)))))))).))))......(((.....))).......))).))))....))))))).)))).((.....))..))))))))))).)).))..))))))).))).))))....)).)))).))))..)).))))))......))))))))))).))))))...)))))))).))).....)))))..)))))..)))).....)).))))))....(((((....((((........)))).((((.........)))).......((((.....))))))))).
Thermodynamic Ensemble Prediction
.((((((((..((((.(((((((((((((((.{,,{{..|,.....|||,|||||,.}}}}},(((,((({,{||{{(((((.((((((((((((((((...)))))...)))).))))))).))))))}}||,((((((((...((((((((((((((,,.(((((.((....)),..(((((((.{,(((........)}))}.})))))))..,.((((((((....(((((.((((..(((((....(((,{(((......)))).)))...))))).))))...)))))......)))))))).))))).((.((((((....)))))).))..},)}.))))))))}})))))))))))((((((.((((((.,.((((((((((((((......(((.((((((..((.(((((.((((...,)))).((((((.((((.((.((((((((((((((((((((((.((((.{{,(((.((((((((((((((((((({.,,,{({(((((...{{...|||||||||}|.{|{{(,{{.,},,{|||.|,|}|||,,,,|||,}}))})).....,|||...{{((,,..))))(((((((((((((((..,,((.((((........)))))).,((((((.(.(((......)))).)))))){{{((((..((((((,((((,,,,}||}(((...,,,|}},(({(({.{...,,|,}}))}}((((((((..(.((.....)).)..)))))))).,.})))}),,)}},,,}}}},{{{((((((.(((,(({(,({{{.,,.)))).}))),((((((((((,(((((,{{||||||||(,((({{,{{((((.({{...}|}}}||{(((({(({(({({.{{(,,..,,|||,||}|{{{,,{||||{|||||,||{..(((((,((,...{{.((.({,...,,)).))||,,,.}}}}))}|,.,.|||||||||||{{((((((..(((({...,))))..)))))}(((((((.((((......))))..))))))){((((((((((((((.{.((((((.........)))))).,,))))))))))))))|{,{((..((((..((......))..))))..)))}},{{,,{({{..|{|||||..(((((((,.{{|||||}}((({,,,,})}}{{(((((({.{{||||||{|,,,|||{{{.(((((((((({.,((((((..{((((((....)))))}}}...))).))))))))))))))..},||.||||{|}||||,.|,||{{{(({{,((.,(((({(({{....)).})))),}),,))))),)}}})))))))))),)).|||{|}}||||||}..,((({{(,((.,..{,|||.....,))).)))),)},))))}}...,,,))))}}.,,||||,.,||}||||}|||},((((((,{.....))))))),,,..,...,,...,))}))}})}},,}}})})))))}))))))))))})}|||}}})))))))}..|||},|||},.,,}||||...,,{{{...,|||},..{{(((((((((((...(((.....,,.{{.||||.{{||||{{(((((....|||||(((((((((((.((((((((((.......)).)))).)))).)))))).)))))((((((......,||,}}|..}|...}.,}),}},|||||{{{{{||||{{,..|.{{,{{{|,..........,}}............(,(((((((((.....))))))))),)}.,,))))))}}},,))},)},}},.}}}}}},..,.,,},.....})).,})))))))})))}.,}.......(((((......))).)).{((({{(((((((({..({{...})}..})))..)))))))))}|(({{((((((.{{,({((......{(((.,.,(((((....)))).)}}.})))}..{|{..|||,,|{,|...(((((.({{....,..(((({{.|....,,,))))))))),.))))).}}}}}}}}}),,||||}||,|||..,|||||,,,.{{{{{.,.....})))),})}}}},.,}}},)))}.)).))))))),)})),}}|||||{.|{|||,|{{|||||||},.(((((..........))))),,,,.{{....((((((......)))))),}},.}))}),))})}).}})))})),,,,,})},...))))))))))))))))))))))))).}}}...{{{{...,{||....}})),)}))))))...))))..(((((.((((..{{...}).)))).))))).(((((({{((({.......(((((((((((.....)))).)))))))....,,({((((((((((........))))),.{{|,,,...)))|||}}}}..,,))))))))))).)))))))))))).....((((..((((..(((.((((.((.....)).)))).)))))))..)))).)))))))))))).)))},)},.....}}})).))..)))))))))......))))..)))))))))).....((((((.((((((.........((...((((((.(((((((.{..(((((...)))))..).))))))).))))))...))..........)))))))))))),.)))))))))))),,|,,|,{{{||{.{{(({,{((...,{{{{|||{|}||,....(((((((....)))))))|}.|||||||}||{.,(({,{,..,.{((({((((({{.........{(((.......)))),||..}}))),..{{{||{{(,,{{{,..|{|||||||||||(,.....,,((((,,..(((.(((((((...(((((....)))))..))))))))))..........{{{....}))...({((((.,,,.((((.(((((((((,(((({.{(((,..(((((((..(((,(((,{,...{|,||,,..,,,{|},||||||||}|||((({((,((((,((((((((,(..(({{,.(((((.(((((...........(((((.(((((.(((.(((((..{((.{((((..{{....((((........)))).....}}...)))).).))).))))).)))))))).....((((....)))).)))))))))).})))).,...))))..}.))}})))),)))})))))),,||.{{||||,|{{.{((((.((((((((((........)))))).....))))..)))).|,,.|||...|||||||,.|||.}}}}.}}}}((((((........,.)))))){(((,,..|||}..(((((.(((.((((((.......}))),.)).))).))))),.})}})))))))))))))))))}.))},.}})))))))))))))))))},.,,,,,|(((((......)))))))))),))))))||.((((((({..,{,(((((((.{{((((...,}}{{{|||||,,,({{...))))))))))),,.{||||{{{,..........}}}))))).}}....}}}|||||,,..|}|||,|...|||||.,}}}||||,,||}}}}}||,|}}}}}}}|}}|,,...|.|||.,.||}.||||||{(({{{(((((((.....)))))))|((((...))))},..,|||||.,,.,,{{{{{||{|{((.((((.{{....{{{{.{||||.{|{{{.,||||,,,.|,,,||||(((((({...(((((((((((((((..{{(,((((.((((.(((({{..................,}.)))))))).))))....,.(((.....))).{{{...))).)))),...))))))).))))..}}}}}}},}}})))))))))},},.,.,,)))))}).))),})))....)).)))),)))}..)).}))))}.....{||||||{||.,.,))},,.})))))))..,})}....,))))),.,))))..)))).....)).))))))....{((((|...{{{{.,......}}}}.{(({.........)))).......{(((.....))))})))}.

Transcripts

ID Sequence Length GC content
ACAGAUAGCAAGUCCUAGUCAGAGCUGCCGCUACAUUUAGGAGAAACAG… 4202 nt 0.5840
Summary

Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. It associates with another G-protein-activated potassium channel to form a heteromultimeric pore-forming complex. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the KCNJ9 (KCNJ9/GIRK3) exhibited increased expression in dorsolateral prefrontal cortex neurons from individuals with cocaine use disorder compared to cocaine-free controls [Huggett et al. DOI:10.1523/Jneurosci.2879-19.2020].