Basic Information

Symbol
KCNK1
RNA class
mRNA
Alias
Potassium Two Pore Domain Channel Subfamily K Member 1 K2p1.1 TWIK-1 DPK Tandem Of P Domains In A Weak Inward Rectifying K+ Channel 1 Potassium Channel, Two Pore Domain Subfamily K, Member 1 Inward Rectifying Potassium Channel Protein TWIK-1 Potassium Channel Subfamily K Member 1 Potassium Channel KCNO1 Potassium Channel K2P1 KCNO1 TWIK1 Potassium Inwardly-Rectifying Channel, Subfamily K, Member 1 Potassium Channel, Subfamily K, Member 1 HOHO1 HOHO K2P1
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Sudden death from CNS diseases

MANE select

Transcript ID
NM_002245.4
Sequence length
2061.0 nt
GC content
0.4522

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-646.60 kcal/mol
Thermodynamic ensemble
Free energy: -686.35 kcal/mol
Frequency: 0.0000
Diversity: 656.71
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((((((.((((.(((((((((((.((((((((((..((.(.((....)).).))....))))))))))...)))))))).))).)).)).)))(((.(((.(((((....))))).))).)))((((((((((....((((.((((.....)))).....(.((((.(((((((((((((((.....(((......)))....))))))).)))))))))))).).))))))))))))))..))))))))((((.((((((.((((.((.(.(((.((.((((((((.((((((.(..((((.((((.(((((..((.....((.((...)).))....))...))))).)))).))))..).))))))....))))).))))).))).).))))))))))))))))..((((((.(((((.....))))).))).(((((((((((.....((.....))........)))))))..))))((((((((.(((..(((((...(((((((((.....))))((((....)))).)))))...)))))..)))..(((.((((((((((((((((((....((((.(((((((((((((((....(((((((.((((((..(((((((......(((((..(((((((((((.((((..((((......)))).))))(((((..(.(((...))).)..))))).......((((....((((((((.((((.((...((....))...)))))).))))))))...)))).......((((..(((.((....(((..((..((.((.(....(((((((.((((......)))).).))))))..)))))..)).)))..)).)))..))))(((((....))))).............)))))))))))..)))))(((((..(((.(((..((((.....)))).....))))))..)))))....)))))))))).)))))))))).((((((..((.........))..))))))))))))))).........)))))).))))((((((((.......((.(((((((...........))))))).))....))))))))(((((((........((((..((((................))))..))))........)).)))))......((((((.((((((....((((((..................))))))....))))..)).))))))..))))))).))))))....(((((((((...(((((((((((.............)).))))......))))).)))))))))))))))))........(((((....)))))..(((((((((...........)))))))))((.(((((((((.(((((((((((.(((((.....))))))))))).)))))..........((((((((((....((((((((....)))))))).........((((((((((((((((......((((........((((((((....((((....(((((...)))))))))..))))).))).))))......))))).)))))))))))((((((((((....))))).))))).((((((((.(((...((((..(((...))).))))..))).))))))))....)))))))))).........((((((...)))))).))))))))).))...........))))))))....(((((...(((((((..(((((.(((((((.(((((.....((....))....))))).))))))).)))......((((((.((((((....((......))...)))))).)))).))...)))))))))...)))))....((((((......))))))....)))..((((((((..(((((......)).))).................((((((...(((((((........)))))))..........)))))).((((..................))))))))))))
Thermodynamic Ensemble Prediction
.((((((({{((((((((.(({{{{|||||,||||((({{{.,|{.{,(({,,,|}{|{||{{,,||}|||||||,|||.||||||,|||,||,||,,(((((.(((.(((((....))))).))).)))||..{{({,.{{,{((({,((((.....)))},|||.||{{{{,(((((((((((((((.....(({|,...,)))....))))))).))))))))||||||}}|||,}}}}{{{||,.,))))),{((({{((((((.((({,((.{.(((.((.((((((((.((((((.(..((((.{(((.(((((.{((,.{,{{{,...}}.},))}}..},...))))).)))}.))))..).))))))....))))).))))).))).).))))))))))))))))}.,.,,((,.(((({{{{{|||||{||{.((,,({(((((({({(({{.,{{((.....{,{{.{{{{{{..|||{...,,,,......,,}}}}..)))))),.)))},...{|((......)))).,,..,,,,))))),,)),}}}.}}}}}|||{,||.||,||||}...,,,..}}.))}||)))}}}}...,|,,}}}}.)}},,,,}))|,||,.}},))}.|||))}})))))))|,,,{{{|||||{|,.,,,{{{,..,{((((((..(.(((...))).)..)))))},.{(((((({{,,,{{(((((,,((,{....,}||,.})))}...|||||{{,,,,,))}}.))),.,.,,,,,,,,,,,{{{(({{,,{{{,,(((((..((((((..(((((((.((((......)))).),,))))).,{{,,.{(((({.,(((({|({(((((.(((....((((((((((((((({...{((((.{,{(((.(((((((,((.{{{.{(((.,......,.))))))}}...))))))).)))))..))))),...(((({.(((((((.,((((((...(((((({...{(((((((((.{.|,{((((...{{(((((....}))))||({((((.......{{.{((((({|........|.})))))).},,...)))))}}.)))))}..}.)))))))))}.,,...,,{,,,,......}})}||...{(((((.((((((((((((({((..((((((.((((((....((((((.,................))))))....))))}.,).))))))..((((,,((((,{.(((..(((((((((...(((((((({{({.,,.......,,.)})))}.....,))))).)))))))))..}))},,.,.)))}.(((((....)))))..(((((((((...........))))))))){{.,((((((({.{((((((((((.(((((.....))))))))))).))))}..........((((((((({....{(((((((....)))))))|,,,,,,,({{.((((((((......}}))})})},.,..,,,{{,,.,,,,||,||{{{,...(((((...)))))}}})))))}},}}}},|||,{{{,,.{{{{(((({{{{{{{,{(((({{,....}))))))}.)))))))}}))}|{{|||,,,}.}|.|}||,({((({{{{...,,,.}))))))}....)))))))))).........((((((...}))))).,)))))))}.}}............)))).........)))})}))))).....)))))).))).)))}},.....}))))))..)))))).........}.))))))).)))))............})))))))))))))))...))).)))))....)),)))))...}))))).}|,((((((......))))))...{(({..,{||,|,,..{{{||......)).)))......)))))).)))))..,,,...(((((((........)))))))..}}}}}},..,,}}),,})}.,,,}}},,,,,,,,.}}}))})))}}...

Transcripts

ID Sequence Length GC content
AGAAGAGGCGGCGGGCCGCGCUCCGGCCGGUCUGCGGCGUUGGCCUUGG… 2061 nt 0.4522
Summary

This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel, however, it may require other non-pore-forming proteins for activity. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the KCNK1 was down-regulated in left ventricular myocardium from cases of autopsy-defined arrhythmic sudden death compared to nonarrhythmic deaths, as part of a dysregulated ion transport signature [Caudal et al. DOI:10.1016/j.jacep.2024.08.013]. In a separate investigation in rats, the KCNK1 was previously associated with central nervous system injuries in multiple array studies, though it was not experimentally studied in that specific spinal cord injury model [De Biase et al. DOI:10.1152/physiolgenomics.00081.2005].