Basic Information

Symbol
KCNK13
RNA class
mRNA
Alias
Potassium Two Pore Domain Channel Subfamily K Member 13 THIK-1 K2p13.1 THIK1 Tandem Pore Domain Halothane-Inhibited Potassium Channel 1 Potassium Channel, Two Pore Domain Subfamily K, Member 13 Potassium Channel, Subfamily K, Member 13 Potassium Channel Subfamily K Member 13 Tandem Pore Domain Potassium Channel THIK-1 K2P13.1 Potassium Channel
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_022054.4
Sequence length
2289.0 nt
GC content
0.5605

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-939.90 kcal/mol
Thermodynamic ensemble
Free energy: -975.27 kcal/mol
Frequency: 0.0000
Diversity: 572.45
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((....((((((.(((.((.((((((..((.(((.(((.((((((((((((...((((((.((((.((((((((.......))))).(((((..(((.((((.((((((....(((..(((.((.((((((......((...((((((.((((......)))).))))))))......)))))).)).)))))))))))).)))).))).)))))((((.(((((((....))))))).)))).(((.....))).............))).)))).))))))))))...(.((((..(((.((((((((((((((((.(((((((((((((...(((((((....)))))))......))))))..)))))))))...(((........)))))))).........(((((((........)))))))(((((((...((((.....((((..((.(.(((((((((((((((((...))))))..(((((((.......)))))))((((((((((((.((....((((((((.(((....)))..))))))))....)).)))).)))))))).........(((((..((((((((((((((((((.((..((((((.......((((((((.((((.((((((((((((((((....))))..((......((((....))))......))))).))))))).)).))))(((...)))((..((((((((((.(((((.(((((.(((((....(((((((.((((..((((((.....)))).)).....)))).)))).)))..))))).))))))))))))).........(((((.(..((.(((.(((...........(((((((((((...(((.............)))..))))).)))))).((.((((((((((((..(((((.....)))))..).))))......))))))))).........((((((((.((((((((.(((((....))))).(((..(((((.(((.(.........(((.(((((.((((((.....((((......)))).....))))))....((.((((((((...))))))..))))))))).)))(((((((....)))))))..).)))))))))))((((((........))))))....((((....)))).)))))))))))))))).)))))).))..)))))).))))))).))(((((...))))).)))))))).)))))))).)))))))))))(((((((((((((.((((......))))..).))))))))))))(((.((((((....((((....))))(((((((........)))).)))......((...((((((((((.((.....)))))).)))))).)).)))))).)))))))))).)))))))))))))))).).))))))...))))..))))))).....))))))))))))..)))).)..))))).)))))).))).))..)))))))).)))))))))((((((((..(((((.....((((....))))....((((.........)))).(((((((....)))))))...(((((((.(((((..((((((.....((((.....)))).........(((((((.((((((((.......((((((((........)))..)))))........)))))).((((((((((..((.((((((((.....)))))))).)).........))))))))))...(((((((.....))))))).....)).)))))))(((.((((((((.......((((......)))).......)))))))))))...))))))))))).)))))))...))))).)))))))).....((.(((((.......))))))).((.(((((((((((..(((((..(((((((((........(((((((.(((((((((((((.((((.....(((.(((((((((.......)))))...)))).)))....)))).))))))...............(.(((((((.(((((.........))))).))))))).)))))))).)))))))........)))..))))))..)))))...))))))))))).))(((((((.....)))))))((((((((......((((((....)))).))))))))))...((((((....)))))).............)))))..........
Thermodynamic Ensemble Prediction
(((((.,,{((((((.(((.((.{(((((..{(.((({(((,((((((((((({|,{((((((,((((,((((({(({{,{,,.||}}|.,(((({.(((.((((.((((((..,.(((..{((.((.((((((......{{|,,((((((.((((......)))).))))))})....,.)))))).)).)))))))))))).)))).))).}||}|((((.(((((((....))))))).)))),||{...,,}}}....}|||,||,,}}},)))),)))))))))).,,|,((((..{({.(((((((((({{|({{{(((((({((((((..,(((((((....))))))).}....)))))).,))))))},|{{{(((,.....,{||{{(((|({.....}},||||||....}}})}|}||||((((({{...,,,|}}}}}||||.|((.(.(((((((((((((((((...))))))..(((((((.......)))))))((((((((((((.((....((((((((,(((....)))..))))))))....)).)))).)))))))),........(((((..((((((((((((((((((.((..((((((.......((((((((.((((.((((((((((((((((....})))..({......((((....))))......))))).))))))).)).))))(((...||},{{{(((({||{(,{(((((.(((((.(((({.,,.(((((((.((((.{({{(({...,.}))).}}.....)))).)))).)))..,)))).))))))))))))},,|||,|{{((|,,...{(({,({.{.{{{(((.{{...(((((((((((...(((.............)))..))))))}}))))..}}.))),..{||||,,{||||..,,,))}))..,.}}},...{(((((({..,|{{{{{.((((((((((,,((((((((.({(((....}|}}|.{{{..(((((.{{{...{{{,,...(((.(((({.((((((.....((((......)))).....))))))...,((.{{((((((...))))))..}}))))))).))){((((((....))))))),,}.}}}))))}}))((((((........))))))..,,||{|,,,.)))).)))))))))))))},)}))))...)),.)))),..)))))))}||(((({...))))).)))))))).)))))))).))))))))))){((((((((((({.{(((,.....))}),,).)))))))))))}(((,((((((,...((((....))))(((((((........)))).))).,}}}}|,.},((((((((((.((.....)))))),}))))).||.}})))).)}}))))))).)))))))))))))))).).)))))),,.))}}..}))}))}....,)))))))))|)),.)))).|.,|}}}},)))}})|}}}.}},,}}}}}})}.||||||}}},((((((,..,{,{{..,,.,,,{....})},....||||}}....,,}}}}|.{|,,,{|}}}.))}||||||,{{{{{{{.{{{||,,||||||,|,{{(((({{.{,||||....,,,,,(((((((.((({((({.......((((((((........)))..))))).....,,.)))))}.((((((((((..{{.((((((((..,,.}}})))}).)),,.......))))))))))...(((((((.....))))))).....}}.}}}}}}},,{,{{{{{{{{......,|||,,},,},)))),,,,,,,))))))},,.,,,.))))))))))).)))))},.....,)))))))))))}.,..,{,{{{({,......))))}))}{{.(((((((((((..(((((..(((((((((........(((((((.(((((((((((((.((((..{..(((.(((((((((.......)))))...)))).))).}}.)))).))))))...............(.(((((({.{(((({.,......})))).))))))).)))))))).)))))))........)))..))))))..)))))...))))))))))).}}(((((((.....))))))){(((((((....{{({{,,,,,.}))...}.))))))))...((((((....)))))).............)))))..........

Transcripts

ID Sequence Length GC content
GAGGACGUGGGGAGCUGGCGCCACAGGAGCUACCGAGGCGGCGGCCGGG… 2289 nt 0.5605
Summary

Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a potassium channel containing two pore-forming domains. This protein is an open channel that can be stimulated by arachidonic acid and inhibited by the anesthetic halothane. [provided by RefSeq, Jul 2013]

Forensic Context

A study in human postmortem brain tissue identified the KCNK13 as a microglial-correlated gene crucial for modulating microglial surveillance and cytokine signaling, with its expression being part of dysregulated angiogenic and neuroinflammatory networks in opioid use disorder [Mendez et al. DOI:10.1038/s41380-021-01259-y].