Basic Information

Symbol
KCNK18
RNA class
mRNA
Alias
Potassium Two Pore Domain Channel Subfamily K Member 18 TRESK TRIK K2p18.1 TRESK-2 TRESK2 Potassium Channel, Two Pore Domain Subfamily K, Member 18 TWIK-Related Spinal Cord Potassium Channel Potassium Channel, Subfamily K, Member 18 TWIK-Related Individual Potassium Channel Potassium Channel Subfamily K Member 18 TWIK Related Spinal Cord K+ Channel TWIK-Related Spinal Cord K+ Channel TWIK-Related Individual K+ Channel MGR13
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_181840.1
Sequence length
1155.0 nt
GC content
0.5082

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-370.20 kcal/mol
Thermodynamic ensemble
Free energy: -393.08 kcal/mol
Frequency: 0.0000
Diversity: 346.67
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((...((((((((.(..((..(((((..((....((((((((..(((((.....))))).)))))))).......((((.(((((((((.....((((((.((((.((((..((((((((((((((((((((......)))))....(((((((((..((.(((((((((((...))))....))))))).))..))).))..)))).......))))))))).))).)))..)))).))))))))))(((...(((((((((((.((.((((.((......(((((((.....))))))))))))))))))))....)))))))))(((((((...)))))))(((..(((....)))....))))))))))))...)))).......(.(((((...))))).)....((((..((....(((((((((.((((....))))..))).))))))..))..)))).....................(((...((((......))))...))).))...)))))..))..).))))))))..)))))).........(((((.(..(((((((((((..(((((..(((.....))).)))))....(((.(((((.((..(((((.......))))).....)).))))))))....((((..(.((((((.....((((((.(((((.(((((((.....(((......))).....((........))...(((.(.(((...))).).)))....))))))))))))...))))))..)))))))..)))).....(((((.(((((.((((..(((((.((((..((....)).)))).)))))...........(((........)))....)))).)))))..)))))..(((....))).((((.(((.(((.....((((....))))..))).))).))))..............)))))))))))...).))))).((((((...(((........)))..(((((((((............)))))))))..)))))).(((((((((((.(((((..((((.....(..((((((........))))))..)..((((((....)))))).))))))))).))))....)))))))
Thermodynamic Ensemble Prediction
..((((((.,.((((((((...,(({{((((({.(((.(((((,,,,,}}|||,,}}},,)}}))}))))),,|{{{,,{{.((({((({{{((({,,{{(((,,{.||||}{||,,|||,(((((((((((.(((((......))))),))))))).|||,..||}|||||,,||||}}}.|||{{{{||||,||{||{.,,,.....))))}}.,...,.|,|||||,,||.|{|..,}}|{||},||||||({{...(((((((((({,({{((((.((......(((((((.....))))))))))))))))))))....)))))),,|(((((((...)))))))|((,.,(({..,|},...,,},))}}}}}))}..||||.|||...,,||{||},..}))),,....||||,,,},|,.(((((((((.((((....))))..))).)))))).,||.{||||...,,..........,..,..|||},}|{,,......)))),,.,,)}))}..))))).,))}}).))))))))..)))))).........{((({.({.(((((((((((,,(({({.{(((,,,..|}}.|||||.,|.{(((((({({((,,(((,((..,,..||||||...,|}.,,})).)},,,,|{||..|,,|||||}|{{.((((((.(((({.(((((((.,...(((......}}}...,|,{.,,,,...||..,(({,(.(((...)}).).))}....})))))))))))...)))))).})}}}}}}.})))),....{||||,{|{{|,|||||.(((((.((((..((....)).)))).)))))...,,......{((........})}....,})}.))})},.}}}}|{{((,....)))}((((.(({,{((....{(({,....})},..,)),))).))))..............,))))))))))...),))))},(((({(...,,,.......,}}}..(((((((((..,.......,,)))))))))..}}}}}}.{{(({{{(({{.{{{{|,|{{||,||,.|,.((((((........)))))),||,.,{{{{{,,,..))))},))))))}}}.}}}}....}))))),

Transcripts

ID Sequence Length GC content
AUGGAGGUCUCGGGGCACCCCCAGGCCAGGAGAUGCUGCCCAGAGGCCC… 1155 nt 0.5082
Summary

Potassium channels play a role in many cellular processes including maintenance of the action potential, muscle contraction, hormone secretion, osmotic regulation, and ion flow. This gene encodes a member of the superfamily of potassium channel proteins containing two pore-forming P domains and the encoded protein functions as an outward rectifying potassium channel. A mutation in this gene has been found to be associated with migraine with aura.[provided by RefSeq, Jan 2011]

Forensic Context

A study in mice demonstrated that spinal nerve ligation induced significant whole-transcriptome changes in injured dorsal root ganglia, with the KCNK18 being downregulated 0.04-fold six days post-injury [Wu et al. DOI:10.1177/1744806916629048].