| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUGGAGGUCUCGGGGCACCCCCAGGCCAGGAGAUGCUGCCCAGAGGCCC… | 1155 nt | 0.5082 |
Potassium channels play a role in many cellular processes including maintenance of the action potential, muscle contraction, hormone secretion, osmotic regulation, and ion flow. This gene encodes a member of the superfamily of potassium channel proteins containing two pore-forming P domains and the encoded protein functions as an outward rectifying potassium channel. A mutation in this gene has been found to be associated with migraine with aura.[provided by RefSeq, Jan 2011]
A study in mice demonstrated that spinal nerve ligation induced significant whole-transcriptome changes in injured dorsal root ganglia, with the KCNK18 being downregulated 0.04-fold six days post-injury [Wu et al. DOI:10.1177/1744806916629048].