Basic Information

Symbol
KCNMB1
RNA class
mRNA
Alias
Potassium Calcium-Activated Channel Subfamily M Regulatory Beta Subunit 1 Hslo-Beta Potassium Large Conductance Calcium-Activated Channel, Subfamily M, Beta Member 1 Calcium-Activated Potassium Channel, Subfamily M Subunit Beta-1 Potassium Channel Subfamily M Regulatory Beta Subunit 1 Calcium-Activated Potassium Channel Subunit Beta-1 Charybdotoxin Receptor Subunit Beta-1 Big Potassium Channel Beta Subunit 1 Maxi K Channel Subunit Beta-1 MaxiK Channel Beta-Subunit 1 BK Channel Beta Subunit 1 BK Channel Subunit Beta-1 K(VCA)Beta-1 Slo-Beta-1 BKbeta1 Hbeta1 Large Conductance Ca2+-Activated K+ Channel Beta 1 Subunit Calcium-Activated Potassium Channel Subunit Beta K(VCA)Beta SLO-BETA Slo-Beta BKbeta
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_004137.4
Sequence length
4742.0 nt
GC content
0.4842

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1553.80 kcal/mol
Thermodynamic ensemble
Free energy: -1640.19 kcal/mol
Frequency: 0.0000
Diversity: 1464.98
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((..((((.....)))).....)))))))....(((((((((((((.....(((((((.......)))))))))))))..((((((((((.((..(((........(((.((((((....)))))).)))(((((((..(((.(((....(((......)))......))).))).)))))))(((......))).(((((((........))))))).......(((((((((((.((...(((.........)))...))))).((((........)))).......((((((((....))..))))))))))))))...((((..(((((......))))))))).))).)))))))))))).........(((.((((((((((.....(((......(((((.(((.(((..(((.......((((((((((....(((((((((((.(((((...............((((((.((((((((((((.(((....))).............(((((........)))))))))))).(((..((((..((......((((.........)))).....))..)))))))((((..(((((((((((((((.(((.....(((((((..(((((((((((.........((..(((.((((.(((..(((...))).....(((((.((((((........(((((((.((..((((..............))))..))))).)))))))))).)))))(((((.........)))))....))))))).)))...))..((((.(((((...(((((......((((((((((...(((((......((((..((((...))))..))))......)))))...)))).).)))))(((........)))((((.((((....))))..))))...((((((((.......((((((....................((((((((((.((((.....(((((.(((((((.((((...))))...)))))))..((((..(........).))))....)))))................((((....))))....((((.((((((...((....((((....))))..((((((((((((....((((((.....................))))))(((((((.(((((.((((((((((((((......))))).))))))))).(((((.....((((((((((((((((((((.....((.(((((((.((((((((((((((((.((..(((....)))..)).))..)))))............)))))).....))).)))))))...)).....))))))))).)))))...............(((((((....))))...)))...))))))..((((((((..((((..(((...((((((((((((((((.(((((.((((((((((...(((.(((((((((..((((((((((((.(((........(((((((.(((.((((....(((((......((((.((((((....))))))....(((((.((.(..((((.(((((((((...........))))))))....).))))..))).))))).........)))).......)))))((((((((((((((.(((...)))))))...........(((((.((((((.....(((.(((.((((((((((((((..(((((((.((((....)).)))))))))(((((((..(((..(((....(((.((((((((((..(((.((((((....................(((((((...((....))......)))))).)..)))))).)))...)))))...))))).)))....))).))).)))))))..((((...(((....)))...))))....((((((((((.......))))....))))))))))(((((...))))).....((((.((((.......(((((....))))))))))))).)))))))).)).....((((.......))))...))).))))))))).)))))))))))))))....)))).)).).))).))))........))).)))))))).(((((((...(((((..((..((.(((((...((((((...((..(((((.(((((..((...(((((((((.(.((...((((.......))))...)).).))))))))))).))))).)))))..))....)).)))))))))))..))..)))))..)))))))(((((((((((....)))))))))))))))))))))))))))..)))))))))).)))))..)))))((((((((((((.((((...((((((...))))))..)))).))))))))))))(((((.....(((((((((((((....(((((.(((.......)))..))))).....)))))).)))))))...))))).)))))))))))...))).)))).))))))))..))))).......)))))..)))))))..))))).)))))))(((...((((((((.((....((((........(((((((((.........)))).)))))..)))))).))))))))...)))...))...)))))).))))..(((((((((...))))))))))))).))))))))))............((((....))))....))))))...........(((.((((........)))))))))))))))...............)))))...)))))))))............)))))).)))))..)))))))))).)))))))))))))))..)))).......((((....))))...........)))))))))))(((((.((((((..(.((..((((((....)))))).)).)..))))))..))))).(((((((((((((...((((((((((((((((.(((...))).))).((((........))))........)))))))).)))))...((((.((((((((....)))))..))).))))((((((((......((.((.(((((((....((((..(((.(((.((((....)).))))).)))))))..)))))))..))..)).....))))))))...........................(((((((...((((.((((((.......(((((...(((.......)))...)))))......)))))).)))))))))))...((((((((((.......))))..))).)))............))).)))))).))))..(((((....).)))).(((.((........)).)))...))))).).)))))))))))))))).))))(((((((.((((((((((.....))).)))))))....)))))))...((((((.((.(((((((.((((((((((...))))))............((((((..((((((((((((((((((((.....))))))))......(((...(((((..((((((((((.(........).))))))))......))..)))))...)))....((((....))))(((((....(((((.((((((........(((((((.....)))))))..)))))).)))))...)))))...(((((((..(((.((((....((((((((.((....(((((......)))))(((((.(((((.(((.(((((((.((((((((((..(((.(((.(((..(((((.......)))))..))).)))(((..(((.....((((((((......)).))))))...)))..))).((((.((((((((((.((((((((.(((((((.(((((..(((....)))..)))))........(((((((((....))).)))))).)))))))((((.(((.(((..((((.......)))).))).))).))))......(((((((......((((....)))))))))))(((((((((.(((((((((((((.((((....)))).)))).((((((.(((((...))))).))))))...............)).))))))).((((((....(((((((((((((.........))))))))...))))).((((....))))............................................(((((.(((((..((((.(((.......))).))))..))).....)))))))....)))))).)))))))))..............))))))))..))))......))))))))))....)))..)))))))).))....(((((((((((.((((..............))))))))...))))))).....)))))))..)))..........))))).)))))(((......))))).))))).)))......)))).))))))))))....))))))))))))...))))))..(((......)))))))..))))))))).)).))))..))).)))))).)))))......)))....)))))))).)).))).((((((........))))))......)))))))........
Thermodynamic Ensemble Prediction
(((((((..((((.....)))).....)))))))...,(((((((,((((((((((..(((((..(({..,,.))),))))}...))))).}....}})),,....,|{..{{{.((((((....)))))).}})}||.((({{((((((((.(((((,,..,,|||{((((((({{{{{,{{{.(((.(((((((.....(((((((........)))))))...))))))).))){{{{.(((((({,(((((({{{{.,...,{((((((({{.,,({,.{{{..{{{,,.((((((((....}}..}))))),,,,.|||{{{(||{..(((((......))))){{{{((((,{,{{{||}||}{,.{...,,,)})})),|||||||||,,||||||{.|},,,,}(((,{{,|||((,,...,,,||,|{||||{,}},{{,{{{{,((({(((((({{,..,,{{{,..{({{,((((((({({((((({((,.,{.|||.........{((,(({((.....,,.)))))})))}}}.,,,.,((((..((......((((.........)))).....))..)))),))|{||..||||||||{{|{||{}|||}....{||{{||,.{{((({(((((.,,,,,,,.,,.,|||}||{|}||,,,|,|,..,)),,,,,(((((.((((({.......,(((((((.{(..((((..,,.....},...))))..))))).)))))))))).)))))|||||,........))))),,,.,)))})).})),,}))}.|{{{.||{||,,.|||||...}}||||(((((({..,(((((,{...,(((({(((,.,,,||}},{||||,...{{|||||,..,}}}.},|||||((({,.,,...|||{|||.((((....)))).{||,{{((({(((({{,....,{((((((..,,,..{{{{,{{,,.,(({{{({,((((((((,.,,,{{{{||.{{((({(.((({...}))).,,||||}}|{{({(({,,{{{{{{{{.,|||...,.||,,|{{.{{{({{.,,....,((({{{,|||,,.{{(((((((((((((.,{....{({{....)))|{,,{{{{((((((({{{{.{(({,...,,.(((((((({.,{{..,..}})|||,....{{{,{,((((({((,(((((......))))).))))))))).||,{{,..........(((({(((((((((.....((.(((((((.((((((((((((((((.((..(((....)))..)).))..)))))............)))))}....,))).)))))))...)).....))))))))).)))))........{(((((((.(((((...((((((((((((..,.{({,..{{{(((((((((((,.((........}}..}),))).,.{((((.((((((((((...(((.(((((((((..((((((((((((.(((.......,(((((((,{((.((((,,,,,(({{..{,.,{{{..((((({....}))))),|,.(((((.((.(,.((((.(((((((((,........,.))))))))....).))))..))),)))))..,,...............,})}},((((((((((((((.(((...))))))).|,....,||.(((((.((((((.....(((.(({.(({(((({{|(({{..(((((((.((({....}).)))))))))(((((((..(((..(((..,.(((.((((((((({..,{{.{((({{..........{{.....,..,((((((...,,....,}......)))))).}..}))))).)))...)))))|..})))).))).,..))).))).)))))))..((((.,.(((....)))...))))....(((((((,,{.......}))}..,.)))))}||||{((({,,,,||}}.....||{|,||,|,,..,.,|||{|}}}}))}}}}|})},})|}},}}))).})},|||{{{{,|.....)}}}},,))),))))))))).)))))))))))))))....)))).)).),))).)))),,......))).)))))))).(((((((...(((((..((.,((.(((((...((((,{,..((..(((((.{((((..((.,.(((((((((.{.((...((((.......))))...)).}.))))))))))).))))).)))))..))....}}.))))))))))),.))..)))))..))))))){{{((((((((....))))))))}})))))))))))))))))..)))))))))).)))))..,|(((((((((((((((.((((...((((((...))))))..)))).)))))))))))},)))},....}))))})}.}}}.}.))))))))))))))))).))))))))}),},|{{{||||{,||||||...,{{{(,,((({{.{{{{|,||||{||||{||{||,.|{,|{{{,,,(((((((....))))))),,,})))}}}})}})})},||,{,{{{{{{.{|...,((((,.....,,|||||((({.........)))).))))),,}}}}}}.}}))}}}}...)))))),.,)))},)))))))),,((((((((,...,))))))))),,},}||||||||,......,,.,}}|||||.....},,}||,,.})}}}}}}}..,,}}))))}...,,,,,||.,.,)))))))))),..,}|||......,,)}}}},,,)))))))))............)))))}.,)))).})))))}})),.))))))))))))})).,)))),..,,{,(((({{{{||||...........}}}||}|}}}|(((((.((((((..(.((..((((({....}))))).)).)..))))))..))))),(((((((((((((...((((((((((((((((.(({...})).))).((((........))))........)))))))).)))))...{(((.(((({(((....})})).}))).)))|((((((((.{....((.({.(((((((....((((..(((.(((.((((....)).))))).)))))))..)))))))..},..))....})))))))),..........................((((((((,.,{((.((((((...,,..(((((.,.{,,..,....,,),,.)))))...,,.)))))).)))))))))))...((((((((((.......)))}.})))},))............))).))))))},))),|((({{....|.}}}}.,||,{({{,{,{{,||,}||,,{|,,}}.,})))))}})))}))))))}.,}||||,,,,|||{{{{{{(,,.,,||||||||||,...,||||}}|......{{,||}|},|||||||||,((((({...,}}))}.}}}||||,}}}).))},|((.(((((.(({,{(((((((.....))))))))})).}},,}})){(((((((.{({((({...,,))),,,.))))))))....,})}.))))....)))))).,,((((....))))(((((....(((({.((((((,.......(((((((.....))))))),.)))))).}))))...))))).{{||||.}}}.{||{|,,,...))))),)),})))}}}|||||}}},}.)))})}))))))}})}|||||},,,}}))))|,{|||{{|||||{{|||((,..((((({{{{...,,,)).}))}.,))}.,,((((({{{(((({{{,||||,|.||,,}||||(,,,||||}|||....,,))}|{||||.||||{{(({({{{{||,|((((..(((....)))..)))))..,,|,,|{(((((({(,...))}.}))))},))})))},,,,,{,,.||||||||,|||,||||},..,))})))}}}}}},}}.,,(((((({{....,,,,}}}})))),,))))),.}||}||}}|||{{({,,{|||.{{{{,,,{|,,},)))}|{{((({.(((,{...,}}}},}))))},,{{,...}}}}},},,,})))}}).,,.))))}}}||||}||||,,|}}}}}},{{{||||},||{{{|,}||{{{{{....|,,,.,,..,,......,|,..,.,......,},}},......,,,..{{.{{{(({{{..||{{.|||.......|||,||||,{{{(({,(((({{{||,||{|...|,.,|||||}}}..............,,,,,,,,.}))))}...}}}})))}{|||,..{{||}}}..(((((.................)))))|||||,,.}|||,,||||}|,,........,{{{{.,,...}|}||{(({{{(({..,....})}}.{(({(({.{{{{{{.|{||,....,{(({.,.|,}},,.,})},)))),,,,.}}}..}||||||,}}}}}}.,,)))))}},,..))}}...,|||||||},,||,|,.,,})))})))}}))))))}}})))}}}.,,,,},|||||}},,,.}}}}}...)).))))))))))))......)))))))........

Transcripts

ID Sequence Length GC content
GAGGCCAAACUUCCUGCUGAAGCUCUGUGGCCUCUUUUGGGGUGGGGGC… 4742 nt 0.4842
Summary

MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the product of this gene, the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that spinal nerve ligation induced significant whole-transcriptome changes in injured dorsal root ganglia, where the KCNMB1 was downregulated by 0.03-fold six days post-injury, as identified by strand-specific RNA sequencing and consistent with the broader pattern of altered gene expression associated with neuropathic pain [Wu et al. DOI:10.1177/1744806916629048].