Basic Information

Symbol
KCNV1
RNA class
mRNA
Alias
Potassium Voltage-Gated Channel Modifier Subfamily V Member 1 Kv8.1 Potassium Channel, Voltage Gated Modifier Subfamily V, Member 1 Potassium Voltage-Gated Channel Subfamily V Member 1 Neuronal Potassium Channel Alpha Subunit HNKA Voltage-Gated Potassium Channel Subunit Kv8.1 Potassium Channel, Subfamily V, Member 1 Potassium Channel Kv8.1 KCNB3 KV2.3 HNKA
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_014379.4
Sequence length
6912.0 nt
GC content
0.4144

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1973.60 kcal/mol
Thermodynamic ensemble
Free energy: -2108.37 kcal/mol
Frequency: 0.0000
Diversity: 1798.55
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((...(((((((...)))))))((((((((((....((....))...((((......))))..((((((((.((((.(.(((((..(((.(((.((((..((((((((.((.(....(((((.......)))))).)).))))))))(((((((((((.....((((.((((.(((...((((((((((((((((((((......).))))(((.(((((((((((((.((((((((((..(((.....)))...((((((((...((.((.(.......).)).))....))))))))......(((((((((...(((..(((((.(((.........(((((((.(((((((.........)).)))))...))).((.((((.....)))).)).((((((....))))))))))........)))))))).)))..)))).)))))((.....))..((((.......))))..(((((..........(((((((.((((((((((((((((((((((..(((((.((.((((.(..(((..((.........))..)))...((((.....)))).((((....)))).).)))).)).)))))..........))))))))..)))).(((((((.(((.((((.((((...(.(((((((.((......))....((((((.(((.((((.((((((((((((((...(((((((((((((((((....((((((.......)))))).....(((....))))))))))))))).)))))...)))))).))).))))))))).)))))))))...(((....)))))))))).)..))))((((.((....))))))))))))).)))...((((..((..(((....(((((.((((((...((((.(((((....)).))).)))).))))...)).))))).(((((((((.(((..(....)..))))))))))))(((.((((((((...(.((((.(.((.(((......))).))).)))).)..)))))))).)))..)))..))..)))).....))))..(((((..(((..((((((.(.((((((..((((((......))))))((((((((((((((...((((((((((((.(((.((((((........))))))))).)))).(((((((...((((((....)))).))...))).....)))).((((((((((..((((......)))).(((..((..(((((((..(((...(((..............))).))).)))))))..))..)))..(((((((((((((........((.(((((..(((((((..((((.(((((((.......)))))))))))((((((((..(((........((((...((((.(......).))))...))))..((.((((((.....((((.(((.(.......(((((((((((((((...(((...)))....))))...)))))))....((((.(((((.((((.((.....)).)))).))))).))))(((.........)))....))))......)))).)))).)))))).))....((((.......))))(((((......))))).)))..)))))))))))))))..))))).))...))))))).))))))))))).))))))))))).))...)).....))))))))))))..(((((.((..(((.....))).))...)))))...........(((((........................)))))))))))).))))))..)))...))))).)))))..)))))..)))))))((((.((.(((((.(((((....))))).)).))).))))))(((.((((((..(((((((((..(((......)))..)))))))....)).)))))).))).)))))....))))................(((((((.(((.......(((((((......((((.((((((...)))))).))))..((((.(((((.((((.((((((((.((.(((((.(((((....))))).)))))))..((((((....(((..........))).......))))))((((((...(((((.....((((.......((((..((((.(((((((((((((..((((.((....)).)))).((((((.((((((((..(((.((((((...)))))).....(((((...)))))((((.((.........))))))((((....((((.(((((........))))))))).))))(((....))).((((((.((((((.....)))))).)).......))))..)))..))))))))..)))))).(((((((((........((((.(((((......)))))......((((.......))))(((..(((((((..(((((((((((((((((((.....((((((((((((..((((((....))).)))..))))).............((.........))..........)))))))))))))))))......(((((((....(((((((((((......)))))...............................((((((..........((((((((....))))))))....((((((((.((..(((((((.....(((((...)))))))))))))).)))))))).........((((......((((((((....))))))))....))))..))))))..((((((((.....((((((((..((((((((((..((((((((((((.((..........((((.......))))...((((((....((.(((((((..............))))))))).))))))..........((((((((((((((((................(((((....(((...))).....))))).)))))))))...)))))))..(((((((((((.((((...((...(((((.......)))))....((((((......)))))).......(.(((((((.(((((........))))).)).))))).)((........)).....(((((((.(((((.((((((((((.(((((((((((((((.....((((((((((...((....(((((............((((.(((((((......(((...(((((..((((((......)))))).........((((((((....)))))))).....(((((....)))))....))))).))).......))))))).))))...............(((.((.((((((..((.(((((((..(((((((((((.((((...((....)).))))))))).......................((.((((((((((((.(((((((.....((((...(((((.....))))).((((((((..((((((....)))))).(((((........))))).....))))).)))..........(((.((...(((((.........((((...))))......)))))....))))).........(((((((((..(((((((....((((((((.((.......)).))))))))....(((((((((((....)))))))))))((.(((..(((((...))))).))).))....))))))))))))))))..........))))...)))))))))))))).))))).))...........(((.....)))..........))))))..))).)))).)))))))).)))))(((........))))))))....))...))))))))))......))))))................(((((((...................((((((.((((...........))))))))))...((((((......((((......))))....)))))).....((((((...(((((.....(((.((((.(((.((...((..((((((.(((..........))).))))))..))...)).))).)))).)))....)))))....)))))).....)))))))(((((((((...((((..((((....))))......)))).)))))))))..((((((((((((((((.((.....(((.....)))..)).))))))).....))))))))).(((((((((((...........(((..(((((...((((.......))))...))...............)))..)))...........))))))))))).........((((.((((.....)))).)))).................)))))))))))))))))))))))))))))))((((((........)))))).))))))..)))))))))))......(((......)))((((((((.......(((.....)))..........(((((......)))))...))))))))..)).))))))))))))(((((((.((((...(((((((.((((..(((.........))).....))))....)))))))..))))...........((.((((.((((((.....)))))).)))))).............)))).)))....)))))))))).))))))))......((((((.((((.(((((((......))))))).)))).))))))(((((((........)))))))................))))))))))))))....)))))))..............(((((((.(((((((((....)))))))))))))))).....(((((.(((..(((((((..(.(((.(((((((...))).))))...))).)..)))))))))))))))((((((.(((............(((((((....((((......((((((((((...))))))))))......)))).......)))))))...............(((...(((((...(((((.....))))).)))))...)))......((((.((((((((....((((((......)))))))))))))).))))((((((((((((((((((.....))))).))))))).))))))..((((((((.....)))))))).))).)))))).)))))))))....)))))))..)))(((((((...)))))))...(((((((.((((((..(((((((.((....)))).)))))...))))))...)))))))....))))))))))))).........)))))..)))))))).))))...)))).....))))..)))))...))))))....((((((((((.((((((..........)))).)).))))))))))...((((.........)))).)))))))).)))).)))))))))(((((((....)))))))..)))))))...))).))))))).............((((.....)))).))))))....))))))))))))).)))............((((((.(..((........))..).))))))...............(((((((.((((((.....((......)).....)))))).))))))).....((((......(((((((......)))..))))....))))((((((......((((((.........))))))((((((((.........((((((((((........((((((....))))))....))))))))))((((((....((((((...((......)))))))).....))))))....(((((((((...........))))).))))...(((((.........))))).....(((((....)))))..)))))))).))))))....((((((.((((................)))).))))))....)))).)))).((((..((.((((((.........)))))).))..)))).....)))))))..)))))))((((................))))...........(((((.((.((....)).))))))).)))).....)))))))))))))))))))))..))))).(((((((.((((.....)))))))))))).)))))))))))).....((((.((((((((((...((...........)).)))))))))).))))......(((((((((....((((..((...(((((((((...((((.....((..(((((((((.....)))))))))..))))))....)))))))))....))..(((((((..(((((((..((((.(.(((((..(((((....)))))..)))))................((((.......)))).....(((((((.......)))))))...((((((((.................................))))))))(((((............)))))..............).))))....)))))))))))))).((((.((((........)))).))))...........)))))))))))))...((((((((((((((.((((((......))))....)).)))))..)))))))))....(((((((((....)))))))))))))))))))...............(((.((((((....)))))).)))))))))..........
Thermodynamic Ensemble Prediction
...((((((,..(((((((...)))))))((((((((((..,,({....)),..((((......))))..((((((((.((((.,.(((((..(({{(((.((((..((((((((.(({(,...{((({.......)))))))),.))))))))(((((((((((,,{..((((.((((((((...(((((((((({{(({.,.{{,,,,..|,.}||(((.(((((((((((({.(((((({{...,}....(((((((.,.(((((((..{(((((...,{{{{.{.{.....{|,|}|||(((((...((((((({(((,,,((..(((((,(((.......,,{{{,,{{.(((((((,........)).))))),,.,))}}|,|{||...,,))))})}}|||||{,,,,}}||}||||,....},..)))}}}}},|}|||||}}||}|||{|.|||{|,..((((.......}}}}..{{{{{..........(((((((.((((((((((.(((((((((((.{(((((.((.((((,,..(((,.((.........}}..}}}.,|{{{|},|,|})}..((((....)))).},)))),)).))))),.........))))))))..}))((((..(((,(((.((((.((({.{.{,((((({(,({....,.||,|..((((((.(((.((((,{(((((((((((((...(((((((((((((((((....((((((.......)))))).....(({....)))))))))))))))},))))...)))))).)))}))))))))).)))))))))...{(({...||}}|}||||,,..})))||{{.{{....)))))))})))}}.)}}.}}))(((({....{{,.,.|||{{,||||{{...{(((,(((((....})}})),||}}.}|||,,.|},|}||}.(((((((((.(((..(....),.)))))))))))).{|.((((((((..,|.({((,(,({.{((.,,...}}}.))),)))).}..)))))))),}|||||||{{}|({{{(,....}))))..}||||}||((,{((((({,{,{{,,,|}}||||}}}))))})|||,.(((((((((((((,..,((((,((,((((.(((.((((((........))))))))).)))).{((({({{(((({(((....)))),||...|||.||..}}}}.|||{({||.,..|{{{......,))).,||,,||},((((((({.,,,..}}|.}}}}}.........))).)))}}))),)).,))},{||{.(((((((((((((.,,,,...,,.{((((..(((((((..{(((.(((((((.......)))))))})))((((((((..(((...,,{{,{,,{,...((({({{{.....}))),}.)))}..{{.((((((.....((((.(({,(.......(((((((((((((((...(((...)))....))))...)))))))....((((.(((((.((((.((.....)).)))).))))).))))(((,,.....,}))),...))))..,...}))).)))).)))))).}}.....,{|.....},)}}|(((((......))))),)))..)))))))))))))))..)))))}))...)))))))},))))).)))).,||||||,,,,,}),},))....,))))))))))))}))|||,,||..|||..}..}))}})}}..},,}..,|..,},,}}||},,,|,|}}|||||......,,,,..,,}}})))))},.,,||||..}},...))))}.)))))..)))))..)))))))(((,,((.(((((.(((((....))))).)).))).)))))){{,.((((((..{{(((((((..(((......)))..)))))))....,,.)))))).,}}.}}}}}.|,,}|}}},{{{{(((({{{{{{,,..}|||||{,.{{{{{|,,,,,,..}))))),..,,,{(({{{|}}|||.{{{|{{({{{{......((((((.....))))))(((((.(((((....))))).)))))....{,((((,...{{(,.........))}....,}.)}}}||{{....,{{{{||||,{{||}}.,,,,,.|||||}}}.}}||,||||||,,,|||....(({({,..,...},,.||(((({{(((({{,.,{{..((((((...)))))),}},,(((((...}))))|||||||.....,},})),,.,{,{{...,||||((((((........)))))),,,.,,}},||},},}}}...},||,||||||,,,,,)}}))),)),,,},,})))))))),,)})))))},..,})))))).)))))))..,.)))))))..(((((......))))}.............(((.(((.({.{{......}.))))).))).((((((((((.,,,,(((((((((,((,,((((((....))).}},,,))))).............{,.||......},.,,,......))))}}})))))))))).(((((((((((((((((((((((((((......))))){((((.((((({.......{((((((.((({((((((.,....,,,.((((((((....))))))))....((((((((.((..(((((((....,{{,,.....,)))))))))))).))))))))...{{,,.,{{{,{|..,.,{{{,....,,,)}},,})}},,,|}}|,,||}}||({((((({(({{{..((((((((..((((((((((..(((((,{,,,||,||......,,,,{{((,......}}}|...{(((((....{,,{{{((({,{{{,,,.,{{,.,|||||}}||{||||||..{{{{{....,|||||(((((((((................(((((....(((...))).....))))).)))))))))..,|||||||{{{{{{{{|{{|||||||..,|,...(((((.......)))))...,((((((......)))))}},.....{.(((((((.(((((........))))).)).))))).}((........))..,,{(((((((.{((((.((((((((((.((((((((({{(({,.....{((((({{{{,,,|{,,..{{|{|..,...,(((({(((({((((((({{{{{,((({,.{{(((..((((((......)))))).........{(((((({..,,||||||||{,{,.{{(((,,,,|||||,...})))).|,},.,,.,,|||||||,|}}|,.,,........,..{{{.{{,{{{{{{..||}||{||||,,{{{((((({({,{{,{|||||,,,||},}}|||,}}},,,,........{{{{{......,.}}|||,{(((((,,(((((((.....((((...(((((.....))))).{{((((((..{((((({{{.,,,}||,,,|||.....,},)))))},...))))).}})..........(((.{{...(((((.........((((...))))......}))))....}}))).........(((((((((..(((((((....((((((((.((.......)).))))))))....(((((((((((....))))))))))){(,,((,.(((((...))))).))).))....))))))))))))))))..........))))...)))))))))))))}.},||||||,,,{.....,..,,.,,,,|||,.,,,,.,,.,|||||{{|,|{||||{|{||,,}|,|||||{{.,{|.{|,.,,,)),))}.}}))...,,|)))))||{{,,,,||||||,{.....,,,.....,{{,,,{|.........}|},,,.,}}||||||.{,,,..,..,}}}}}))))))))))}}.,,{{,,{({{,.,,.|}}}}..}}})},}}))))})}}}},{|{{|{..,|||||,..,,,,|,||||,||{,||||}|{..((((((.(((.{,....,,.))).))))))..)),,....}||{||||.,,,,..,))))},}}})}|}||....,||)))|{(((((((((...((((..((((....))))......)))).)))))))))}.((((((((((((((((.({....,(((.....))).,)).})))))),,...))))))))).{((((((((((....,{{...,||||,,||,{,.,||||.....,,)}}}...}},}},,,.,,,,,,,,}},..,,},,},,,,....}))))))))))...........,...,,})))}}))))})}}},.........,,,....)))))))))))))))))))))))))))))))||{{{{........})))},.,}}},),})))))))))))}))))}|,|}},}},,}|(((((((({{,....(((,,...|||..........(((((......)))))...,}},,,}}||||.,,},||||,,})}},.,}}}|,.....{((((((.((((..(((.........))).....))))....)))))))...,}}}}}}},}}}|.((.((((.((((((.....)))))).))))))..{,.,..,,.}))})}.}))))},)))))))))).))))))))......((((((.((((.(((((((......))))))).)))).))))))(((((((........)))))))..,{{{.,........,,}}}},,,{{{{{,..{(({{{{{,...,.........(((((((.{((((((((....,))))))))))))))),,...(((((.(((..{((((((..(.(((.(((((((...))).))))...))).)..))))))))))))))).,,.....{{|||,,{{{,...|{{{|||.,,.,,(({{,{{.((((((((((...})))))))))..,}.,))}}.......}}))))}{{{.{{.....,}}.|||...{{{{{...(((((,...,))))).})))}...,,,...}}}||||,|||{{{{|....|{{|{{......))))}}}|||||||.,,,}|||||{((((((({((({.....}}))).)))))))},))))),,||||||{{|,,,}})))}}}}...}}))))))}},,.))))})))))))))))}))))(((((((...))))))){,.(((((((.((((((..(((((((.((....)))).)))))...))))))...)))))))..,,......,,,.,(((.......))))}}((((((((....,.(((....)))......)))))))).............((((((((((.((((((.,,....}..)))).)).))))))))))...,{{{,........}}},..))))))).)))))))..)))))))).{((((((({{(((,{{.(({....})},}))))))))))))}........((((.....)))).))))))....,)))))))))))).)))...........,((((((,(..((...,,...}|,.|,|}||||.......,{{{({{.{((((((.((((((.....((......}}.....)))))).))))))|.....((((......(((((((......)))..))))....)))){{{{{{.,,,..((((((.........)))))),,,,{{{,.........((((((((((........{((((,...,))))),....))))))))))((((((.,..((((((...((......))))))))...,.)))))),,..(((((((((.,......,},))))).))))..,},,.,,,||....}})))}.....{((({....}))))..}}}))),,,)))))}....((((((.((((..............,})))).))))))....}))),)))}.((((..({.((((((.........)))))).})..)))).....)))))))..)))))))((({...,,,..........}}}}...........((((,{((.((....)).))))))).)))).}},.)))))))))))))))))))))..))))),(((((({,((({.....)))))))))))).))))))))))))....,((({.{{|{((((((...({..,........}|.))))))}})},)))}......{((((((((....({{,..{{,..(((((((((,..((({....,((..(((((((((.....)))))))))..))))))..}.)))))))))....}|{.{((((((..{((((((..{{{{.{,(((((..{{{{{..,,)))}}..}}))).......,,,......{(((.......)))}.....,{{{|{|....,..}})))),...{(({((((,.(,,,.......},,}.}.||......,},..}}}))))}{((((..,,........}})}}.,,,,..,....,.,.}))).},,})))))})))))))}((((.((((........)))).}))}...,,....,,}},,))))))))},,.((((((((({{{{{.,|||||,.....}}}}..,,}},})))),.)))))))}}....(((((((((....)))))))))))))))))))..,.,........,.{((.((((((....)))))).)))))))))..........

Transcripts

ID Sequence Length GC content
AAGGCAGCAGGCGCUGGGUAGAGCUCAGCUGGAACACAGUUUCCCUCCU… 6912 nt 0.4144
Summary

Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium voltage-gated channel subfamily V. This protein is essentially present in the brain, and its role might be to inhibit the function of a particular class of outward rectifier potassium channel types. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human traumatic brain injury (TBI) tissue identified the KCNV1 as part of a positively correlated lncRNA-mRNA pair in a co-expression network, with an absolute correlation coefficient value > 0.99 [Yang et al. DOI:10.4103/1673-5374.247467].