Basic Information

Symbol
KCNV2
RNA class
mRNA
Alias
Potassium Voltage-Gated Channel Modifier Subfamily V Member 2 Kv8.2 Potassium Channel, Voltage Gated Modifier Subfamily V, Member 2 Potassium Voltage-Gated Channel Subfamily V Member 2 Voltage-Gated Potassium Channel Subunit Kv8.2 Potassium Channel, Subfamily V, Member 2 KV11.1 CDSRR RCD3B
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_133497.4
Sequence length
2178.0 nt
GC content
0.5941

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-911.00 kcal/mol
Thermodynamic ensemble
Free energy: -946.74 kcal/mol
Frequency: 0.0000
Diversity: 469.92
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((((.....)))))))(((((((((((.((((((((((......))))))..))))...))))((((((..((.(((.........))))).))))))..(((..((.(.(((((((.((.....)).).))))))).))..)))(((((((...(((.(((.(.(((.(......)))).)))).))))))))))...(((((((.(.((((((((((.((((.(((((..(((((((......((((((((.(((((......(((((((....(((.(((((....((((((((..((((((.(((((....)))))(((((.(((......))).)))))(((..(.((((....))))..)..)))....................(((.(((((.(((((..(((((..(((((((((((((.(((.(((((..(((((((((.(((((((.((((.((((.(....(((.........)))....).)))))))).).)))))))))).(((((..(((...(((((((.((.((((((...((((((.(..(((((.((((((((((..((...((......)).))..))).)))).........))))))))..))))))).)).)))))).))..)))))....)))..))).))......)))))..)))......)).))))))))).)))))))....)))))..))))).((((((((((((........(((((((((..(((((((((((.(((((.((.(((((..(.((((((((..((....)).)))))).).).)..))).)).)).))))).))))))))))).....(((.(((..((((((............))))))..))).)))(((((.((((.(((((.(......).))))).)))).)))))...))))))))))))))))))).))............(((((..((((....(((((((((((.....))))))))))))))))))))((((....)))))))))))).(((((((((((((......(((((((((((((.((((((((.(((((((.(((((...((((.((........)).)))).))))).....((((((((.(((.......))).)))))))))))))))..)))))))).))..))))).((((((...(((((((((.((.(((((((...........((((((....(((((......)))))))))))....))))).)).)))))))))))))))))..((((........))))..)))))).((((((((((.((((((.((...(((..((((.....))))..))))).))))))))........((((((((((((...(((...)))..)))))))...)))))))))))))))))))))))))))).)))))))))))).....))))).)))))).))))...........))))).))))))))))))))).)))))......(((((.(((((.......................))))).)))))(((((((........))))))))))).))))))......(((((........)))))(((((((((.((((((....((.(((((.((((((....)))))).((((((........))))))........(((.........)))..))))))).)))))).((((.((.....))))))((((..(((((((...(((((...((((((((.(((((......((.((((.((((((...(((((((.(((........)))....))))).))((((...(((((((((...((((..((((((((......))............(((((((...((((((((((((((...)))))))....)))))))...))))))).............))))))...))))..))))))))).))))......................))))))..))))))......))))).)))...))))).)))))..)))))))..)).))........))))))))).(((((((.(((....(((....)))))).)))))))))))).)))))))...........)))))))....
Thermodynamic Ensemble Prediction
...(((((((.....)))))))((((((({((((((,(((((({.(,((.||{(|({,||}}....||}((((((..((.(((.........))))).)))))).}}||}}||}|}{||||{,}||..}..,,,)})))}},,.,}..},,(((((((...(((.(((.(.(((.{......)))).)))).))))))))))...(((((((.(.((((((((((.((((.(((((..(((((((......((((((((.{((((....,{(((((((....(((.(((((..,.((((((((..((((((.(((((....)))))(((((.(((......))).))))){(((((.......))))).,.,,{{......................((,,(((({.{((((,,((((({.(((((((((((((((((.(((((..((((((((,{(((((((.((((.((((.,....(({..{{{....)))....).)))))))).)})))))))))).(((((..(((...(((((((.({{((((((...((((((.{..(((((.(((((,,(({..,,...,(....,,},.|},,})},)))}.......}}))))))))..})))))).)),}))))).})..)))))....)))..))).))......)))))..)))......)).))))))))},)))))))....,}))}.}}}}||{((((((((((((.,,{,...((((((((((,(((((((({{((({(((,((.(((((....(,((((((,{{,....,,.},)))),)})}.,.))).)).)).)))).})))))))))))}},,,(((.(({..||||||..,......,.,||}|||,,|}}.,}}|||||,{|||.((({(,(,,,,..}.))))),)))).))))),,.,))))))))))))))))))})).,|||,....,.{((((..((((....(((((((((((.....)))))))))))))))))))}((((....)))))))))))).{(((((((((((({{....{,{(((((((({{.((((((((.((((((({((((,,..((({.{|},...}}})).||||,,,}))}.}}.((((((((.(((.......))).)))))))))))))))..)))))))).}}..)))))}||{{{{...((((((((,,{(,(((((((,,,.....,,,((((((...{(((((......))))}))))))....||}}}.)),})))})}}})}))))))..||||,|,.,,|,}|||..,,}})}}||,||||{|||.||||||||..||||}}||||||.,.||}},,}||||{,,.....))))}....,{||{{{|{|{|,|.{{{...})).})))))))...}))}},,,)}}))))))))))))))})).)))))))))))).....))))).)))))).))))..,,.......))))).))))))))))))))).)))))......(((((.(((((.......................))))).)))))(((((((,,...,,.))))))))))).))))))......(((((........)))))(((((((((.((((((....((.(({({.{(((((....)))))}.((((((........))))))........(({,..,,|.......,))))))).))))))..,{{.{{.....},||,(((((..(((((((...(((((...((((((((.(((((.{,...{.(((((.((((((.,{(((((((.(((........)))....))))).)}|{((...(((((((((.,.((((,.((((((((......)).,{,...,},..(((((((...((((((((((((({...}))))))....)))))))...))))))).............}))))).,.)))),.))))))))).}))}.{,,.......,,,,},.....))))))..)))))}....},))))).)}),,,))))).)))))..)))))))..)).))),,.....))))))))).(((((((.(((....(((....)))))).)))))))))))).)))))))...........}))))))....

Transcripts

ID Sequence Length GC content
AGAGCAGUCAACAGCUGACUGCGUUCAGACCCUGCAGGCUGGGCUGGCC… 2178 nt 0.5941
Summary

Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium voltage-gated channel subfamily V. This member is identified as a 'silent subunit', and it does not form homomultimers, but forms heteromultimers with several other subfamily members. Through obligatory heteromerization, it exerts a function-altering effect on other potassium channel subunits. This protein is strongly expressed in pancreas and has a weaker expression in several other tissues. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the KCNV2 transcript, a potassium voltage-gated channel subfamily V member 2, increased in abundance at 24 hours postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267].