| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUCCCGGCUCCAGCUCCGCCGCCAGCUCCAGCCUUUGCUCCCCCUCCC… | 1550 nt | 0.5452 |
Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, which is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. The protein encoded by this gene was the first member of the family to be identified, and it encodes a protein structurally and functionally similar to the yeast ERD2 gene product. [provided by RefSeq, Jul 2008]
A study in primary rat microglia demonstrated that alcohol exposure alters the transcriptome, significantly increasing the expression of the KDELR1 among other immune effector response genes [Kalinin et al. DOI:10.1186/S12974-018-1184-7].