Basic Information

Symbol
KDELR1
RNA class
mRNA
Alias
KDEL Endoplasmic Reticulum Protein Retention Receptor 1 ERD2.1 ERD2 HDEL KDEL (Lys-Asp-Glu-Leu) Endoplasmic Reticulum Protein Retention Receptor 1 ER Lumen Protein-Retaining Receptor 1 Putative MAPK-Activating Protein PM23 KDEL Receptor 1 PM23
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_006801.3
Sequence length
1550.0 nt
GC content
0.5452

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-527.00 kcal/mol
Thermodynamic ensemble
Free energy: -556.64 kcal/mol
Frequency: 0.0000
Diversity: 351.68
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.((((.........)))).((((((.(((((..(((((((((((.....(((.......)))..))))...((((.((((((.(((.(.(((((((.(((((.((...............((((.(((((((((...)))))))..)).))))((.(((((((((.....(((((((((((.(((((....(((((......)))))))))).))).(((((.....(((((((....(((((((...((((....(((((((.((((((....)))..))).)))))))...)))).((((((((((.((.(((.....))).))..))))...))))))...(((((...(((.((............((((..((((((.(((.......)))....)))))).)))).(((.((((.....((((.........))))....)))).)))((((.((.((((.((((((((......(((......)))...)))))))))))))).))))......((((((((......(((((((((...)))...))))))......))))))))(((((......))))))).)))...))))))))))))..))))))).))))).......................(((((((((((.......))))......(((......))).))))))).........((((((((((..((((...((((((...)))).))...)))).))).))))))).(((.(((((((((((.(((.((...(......)...)).)))))))))))))))))..(((((.......)))))...............))).))))).))))))))).))((((.(((((.....((((..((((..........(((((((..((((...))))..)))))))...))))..))))))))))))))).)))))...))))))).).)))))))))))))...)))))))..))).)).))))))(((((((......(((...((((..((((.(((((..........((.((((.........)))).))....))))).))))..)))).)))........)))))))........(((.(.((...(((((((((.((((.............)))).)))).)))))...))..).)))...(((((.....((((((((.((.(((....)))........(.(((.(((......(((((.((((((......((((.(((((.....((((((((......)))..)))))...(((((((.((((((((......)))))))).(((.......)))...............((((((........))))))..))))))))))))..))))......))))))...)))))....)))))).))))))))))).....))))).(((((........))))).........(((((.(((......)))...))))).............)))).........
Thermodynamic Ensemble Prediction
.....,(((...{{{{..||,|.((((((.(((((..(((((((,,,,....,({(.{{{...,))).)))}.,.((((.(((({({(((.(.(((((((.(((((.((...............((((.(((((((((...)))))))..)).))))((.(((((((((..{,.{(((({((({{.{{{{{....(((((......)))))}||||,|},,,||||,,,,.(((((((....(((((((.,,((((....(((((((.((((((....)))..))).)))))))...)))).((((((,{,,.((,(((({{..,,,.||..},||,.,||||||,,{(({{,..,(((,,,............,|||,,||||||.||||},.,,},,..}}.}}}})),))))}|{(.((((.....((((.........))))....}})).)}}((((.((.((({,((((((((......{((......)}},,,))))))))))))}}.}}}},...,.((((((((......(((((((((...)))...))))))......))))))))(((((......))))),},)))...))))))))))))..))))))).)}|||........,{,........|,..(((((((((((....,,,}}}}...,.,{,.......))),))))))).........((((((({{{..((((...{{((({...)))).})...)))).))).))))))).{{{.{((((((((((.(((.{,...,......)...}}.)))))))))))))|||,..(((((.......)))))...},,.........,}}.)))))}))))))))).))(((,{(((((.....((((..((((..........(((((((..(((,...})))..))))))).}.))))..))))))))))))))).)))))...))))))).).))))))))))))),..)))))))..))).)).))))))...}}}}}}....))}...,{{,,{{(({..{{{,,............,,,|}}}}},..}))}}.,,.((({((((((((({{({,{,({{.....,....,,},}},},,...|||,{.({...(((((((((.((((.............)))).)))).)))))...))}.,.}}}...(((((.....((((((((.{({(({....,,,........{.(((.(((......(((((.((((((......((((.((((({.,,.((((((((......}))..}))))...(((((((,((((((((......)))))))).{((.......))}.........,,.}}}|(((((........))))))..,}}))}))))))..))))......))))))...)))))....)))))).}})))))))))...,.))))).{((((........))))).,{{,....|||{{.{{{,,,...}}).,.}|||}...}}},.,,..))))))))))))..

Transcripts

ID Sequence Length GC content
CUUCCCGGCUCCAGCUCCGCCGCCAGCUCCAGCCUUUGCUCCCCCUCCC… 1550 nt 0.5452
Summary

Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, which is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. The protein encoded by this gene was the first member of the family to be identified, and it encodes a protein structurally and functionally similar to the yeast ERD2 gene product. [provided by RefSeq, Jul 2008]

Forensic Context

A study in primary rat microglia demonstrated that alcohol exposure alters the transcriptome, significantly increasing the expression of the KDELR1 among other immune effector response genes [Kalinin et al. DOI:10.1186/S12974-018-1184-7].