Basic Information

Symbol
KDR
RNA class
mRNA
Alias
Kinase Insert Domain Receptor VEGFR2 FLK1 Vascular Endothelial Growth Factor Receptor 2 VEGFR CD309 Kinase Insert Domain Receptor (A Type III Receptor Tyrosine Kinase) Protein-Tyrosine Kinase Receptor Flk-1 Fetal Liver Kinase 1 EC 2.7.10.1 Tyrosine Kinase Growth Factor Receptor Fetal Liver Kinase-1 Soluble VEGFR2 CD309 Antigen EC 2.7.10 VEGFR-2 FLK-1
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_002253.4
Sequence length
5833.0 nt
GC content
0.4701

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1803.90 kcal/mol
Thermodynamic ensemble
Free energy: -1912.79 kcal/mol
Frequency: 0.0000
Diversity: 1982.38
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((((....))))))((((((.(((((((((((((..((((((((((((.(((((.((.(((.....))).)).)))))......((((((...(((.((.((........))))))).....))))))(((((((((((((((..((((((((((((((...(((((((((((...........)))).)))))))....((.((((...((((((((((.((.....))..))))))..))))...))))))((.((((((..((((((.....)))))))))).)).))...(((((((((.(((.((.((.....)).)))))...))))))))))))).)))))).)))).))))))(((.(((((((((.(((.((((((((........))).)).)))..))).)))))........)))).))).................))))))))).)))))))).(((((((((((.......((((((((....((.(((((((((.((((((((((((((((((((...(((((((((((((((.((...)).)))........((((.(((....)))))))(((((((...)).)))))...(((....))).....(((((((.(((((((((((((.(((.((.(((((((((((((..(((((((.((.....(((...(((((((((((..((((......................)))).)))))))))))...(((.(((((((((((.((..(((.(((((...((((((...(((((....((((((((((((....)).))))).)))))))))).....((((((((......(((((((((...((((.(((((...)))))))))(.((((...)))))............((((.((((....(((((........(((((.(.((((((.(((.((((((.......(((((((....(((((...)))))...)))))))..(((.......)))..)))))).))).)))))).).)))))........)))))...)))))))).)))))))))))))))))....((....))........))))))..((.((((...........)))).))))))).)))..)).))))((((((..(((..(((...((((((..(((((.(((((((((((.((((((....))))))......(((((....((((((((.......(.((.((((.(((((((((.((..(((.....)))..)).))))..(((((((...(((((.((((...)))).).))))...)))))))....))))))))))).))))))))))))))...............(((((.........)))))))))).)))...............((.((((((((...............((((((((((((((((..((((.....((((((.........................(((((((((.(((((((((((((((((((..(((.......))).)))))..((.((((.........)))).))((((((((.((..((((...(((((((.((((.((((((((((..(((....))).((((((((((((((....((((.((((...(((.(((((.(........).)))))..)))..))))...((((.....))))....((((....)))).....))))...)))))).((....)).))))))))......................((((((......))))))........(((....))).....((((((.....)))).))...))))))))))))))......(((((((.(((((.......(((((.((((((........))))))))).)))))))(((...))).......)))))))....(((((((...((........))...)))))))...))))))))))).))...))))))))...))))...))))))))((((..(((((..((((((((((.(((.....((((((.......)))))).((((((.(((..((((((((((.(((((((...(((.((((.(((((.((...(((..((....))..)))..)).))))).((........)).((((..(..((.(((((((((...)))).))))).))..)..)))).(((((....((....))...))))).))))..)))...))).)))).))))((((((.(((.(((.(((..((((((....((((.((....((.((((((((.((((.((....))))))....(((((((.....((((((((.(((((....)))))....((((((.((..(((....)))..))...)))))).....(((((((..((.(((((((((((........)))))))..(((((.(....))))))......((((((((((((((.....(.(((((((.....(((((((((((((.......))))))))(((((..........))))).........)))))....))))))).)..)))).)))))....)))))...)))).))..)))))))..((.((((...)))).))..))))))))..(((....))).......((((((....)))))))))))))...(((((((...((..((((((((.........)))))))).))...))))))).))))))))..)))).))))..))))))...)))..))).))))))))).....))))))..)))))))))((((((..(((.......((((.((..(((((((..(.((.....((....((((((((((((((.(((.....((((((.((((((.((........)).)))..))).))))))....))).))....((.((((((((((..((((((.(((...........)))))))))((..((((.(((((..(((((.((((........)))).....))))))))))))))..)).............(((((((((..........))))).))))((((......)))).))))))))))))....(((((((((((.........((((((((.(((..(((.(((..((((((((.....))))))))))).)))((((.......)))).....(((((.(((.((((..(((((.((((.(((......)))))))........))))).)))).))).))))))))))))))))(((((((((.....)))))))))..(((....))).))))))))))).(((((((((........((((((((..((..(((((((((......(((.(((((..(((((..(((.((((..........))))......(((((((((..(...((...(((..((........))..)))..))....)..)))))))))..((((.((((.(((((.(((..(((((((((((((((((.(((((.((.(((((.(((((.((((......(((((.....)))))......)))).)))))))))).))))))).........((..((......))..))............)))))))))..).)))))))))).))))).)).)))))))))))))).))))).))).)))))))))(((((((((.((..(((((((((....((((((.(((....)))..))))))..((((........))))(((((((...(((((...)))))...)))))))...((((((..(((.(((((.(((.....(((.(((((((((((((..((.((..........))))...))))))............))))))).)))...)))...)))))((((...((......))....))))((((((....)))))).................))).))))))..........)))))))))....((....))...((((.(((.(((((....(((.((((((.(....(((((.........))))).....((((((....)))))).((((.(((((((...((.(((((((((.(((.((((...........))))......((((((.(((((((......))))..))).............(((((((((((.....(((............))).......)))))))))))....))))))...)))))))))).)).)).)).)).))).))))...).))))))....)))......))))).)))))))..)))))))).)))....))..)))))))))))))).)))....((((((((.(((.(((((.......))))).))).)))))))).)))).))))))))...))......))...)..)))))))..))..)))))))))))))....))).)))))).))))..)))))..)))).)).)).)))))))))))))...))))....)))))))))))))))).............))))))))))))).)))))..)))))).....)))....)))..))))))))))))).)))....)))....)).)))))))..)))))).........)))))))..)).))).)).....)))))...)))))).)))))))...))))).))...(.(((((((((..(.(((((.((((((((((((.((((.((((....)))).)))).))))))).(((.((.....)).)))...((.((((..(((....))).)))).))))))).)).))).)..))))))))).).......((((...(((((.((((((..(((((.(((((((((...(((((((((.(((...(((.....((..(((((..(((((((.(((((.((((((((....((((.(......).))))...)))))))).....)))))((((((((((((........))))...(((...)))...))))))))...))))))))))))..))......)))...))))))))))))))))))))..........(((((.((((((....(((.....)))..))))))..))))).((((((((...(((((((..(((((....)))))((((.(((.(((.((.((((.(((((...))))).).))).))))).)))..)))).....)))))))))))))))............((((((((...........))))))))....).))))).)))))).)))))..)))).))))).))).))))))).....))))))))))......((((....))))))))))))).))....))))))))))))))..))))).....((((((((((((.......(((.((((.((((....(((((....((((((((((((.......................)))))...((((((....))))))...)))))))....))))))))).))))))).......))))........)))))))).))))..)))).))))))))....).)))))).....((.((((((((((((...(((((..((((.....)))).)))))...)))).))).))))).))(((((((((.(.(........).)))))))))))))))...(((((((..(((....)))..)))))))..........
Thermodynamic Ensemble Prediction
.(((({((((((....)))))).((((((((.....)))))))).,((((((((,..(((((.((.(((.....))).)).)))))...{,(,....)))..((((((..((((({......((((((((((((.((((((((((({((((,,((((((.(((((....))))).).))))}..,,}),.}.)}))))))))).(((.((.(((({{{((((((((((.,{,....,),.))))))..))))....,,((.((.((((((,.{{((((.....)))))))))).)).)).)),,(((((((.(((.((.((.....)).)))))...))))))))))))}}),))))).)).))))))))}.,))).,((((,({{.((({{,(({....,,.,}),),.}}}..))),))}||,.....,,}),....,{{,.,((((({..{{.,(((((((((...{.(((.(((((.(((((((,,((,(((((,((,.{((((..((((((...(((.(((((,({{(({(((({(((({({{{{{{{{{||,,|.||||||{..{((((,,{(((((((,...{{{{{{{{{{.(((((,,(((((((({(((({....,,.||||{{(({((({{({,,,(({(,(((({.{{{{((((((.{{{((,.,.{{{{,,}},,.}))}}...|{||||||||,}}||,|...}},.},,},...,||....})}|,|||||||||||,.{((({,,,..(({{(,,({..(((.((((({{,(((,,{...(((((....((((((((((((....)).))))))))))))))))...{,((((((((......(((((((((...((((.(((((...)}))))})){,{{{(.,.}}}}|............{{,,,{{|,,|||{({|{|||||.,,{((((.{.((((((.(((.((((((,,..,{.{((((((....(((((...)))))...)))))))..,||,,|,.....,..}))))).))).)))))).).)))))..,...,,}}}}}},,})}))))}.))))))))))))))))),...|{,,,.)),},,,...||||,...{{.{{{{.........,,}})),))}}))).))}..)}.,,,))}}}(((((............))))).})))))}|}||||{.(((((((((....)))))..}))).,}}}})}}}|},||,|},}}},.,}}}}.,}}))})}},))))}}.....,,}}}}))))}))}))))}|||||||||||||,|||||||||}||||,|}|||{,...}|||||{.{{((((((...{{{{{,{((,.....,...|||..........))|||......((....,,,,.{{{.,....,,,..........)))))).}}...})}})}}}}||}}}|}||}|||,.,({((,({{(.......,.}))),.}}|||||,,.,.||........|||}|}|{|},||||}({({{,,,.|||||,,,|,.,{|||{{,...{{(((((.((....)).)))))))...,))}))}),}}.)))))..,||,}}}}}.....,)))).}}}...})))),,,))),,}))})))}})).))))..)))))}})))))||,{(({{.{...,,.},),))))}}))))}))))))).((((.....))))..))).}.))))))))).,}})))))}.})))))))))..)))))))))))))).,{(((({..,,.....,..||||||}..,..,,,,}}.(((...(((({...,,.........))))).))){(((((({....)))).)))).(((((((((((((..(((..((((((({(((.(((((((((((((((..(((((((..{.((((...))))}((((...{((((({,{((.,(((((({{(,({(.,,,({|{,,.||,|}||{{{{((({({,,({((((({{...,..{{{||.,.{{({{{{{{||}.,,,||.,(((.....}}}..,)},,..}},||||||......,)))))}.||||||,||({,((,((({{{{.{{{(((,...,{{.{{{|.|||{|}||,..,({,{({,..,||,.|||,,},.}}}}},((,,,,,,,,||,,((({.{,,((,(({((((((,.,||||,||||}.}|..}.|||||,(((({.,..,,....,|.|,|||||.}||}{{||}...||}.})))|})|}({{,,|||||.{{,{(((..,||||({{.,((((.((,{,.,{.((((({,,.((({.{,.,{{||||||,,,,{(((((({....{{{{{(({|{,,,..}}}))|,,....,{,|||}|}},{{||,,{|||,|}|||||||,,,.|||.{(({((({.,{|,,,.(((((((........)))))))..{{{((,{,,..||||||{(...((((((.((.{.,|.,,.,.}},))),))}...}}}|}|||,|||{||......}}}}}}|}||{,,...,{,.((((.(((.,((((({..,||.,,..,,}}}}.})))))}.))).)))),)))|||{{|||||,|||.||}|||}..((.((((...)))).))...)))})))..,,,..{{|||({{{{||((((.({{{{{{|||||||||||...,{{||||}},|,..{{||||||.,},.,{,,|}}}}}}|,|,...,}||||,.,,,)))),..,},)})},,..}})))),..,|,{{|||{||,||,,,),.}}}))))),,.,,,,,||||.{((,((({,......|}||,,.||,.|}}}},}}}})))})).}||....,{|{{...(((((({((((((.,{((((({({{(({{({,,,,{,.,}}.|||..}}}.|}||}}.....,{({{,||{{..,{{{((((((..((({((.(((......,,,.,)}})))}})||},|{{|,|||||,,(((({.{{{({.,....||||......))))}}}}|||}}||,||.,,.,........(((((((((..........))))).))))|(((,....,|}},.||||||||||},{,..(((((((((((,.....,,.((((((((.(((..(((,(,...((((((((.....)))))))).,}.}))((((.,....}))))...,.(((({.(((.((((..(((((.((((.(((.....,))}))))........))))).)))).))).})))})))))))))))(((((((((.....)))))))))..(((....))).))))))))))).{{{||{{|{,.......|(((({,,.}|}}..{{{||||{,,....{{{.{{{|{..(((((,,(({,((((.{{....,,.))))..,,..{{(({{{{{.,(,,,{{,,,(((,,((......,,)),.}}}.,,,,,,.,..})))))|||,.{{{{.((({.{((((,{{(..{{{{{|{{{{{{{{|||.,{{||,|{|(({||.,||||.|{{|}.,||.{{|||..,,.}))))..,,{{||,,.,,,,)))))).}})))))......{{{{{,,{(...,,.|((,|||||,,,,.....}}}||||},..|,}||||}}}},.))))),}},)))},)))))}))),|||||,|||,||||}}}||({{{(((((,{(..(((((((((...,((((((.(((....)))..)))))).|{{,,........,|,|(((((((...(((((...}))))...)))))))}.,{(((((..({{,(((((.,{,.....(((.(((((((((((((..((.((.......,..))))...))))))............))))))).)))...}}}...))))){{{(,..((......))..|.}))}((((((....))))))...,...........},,}}.)))))}..........)))))))))...,||,,..}),..||||.,(({(((({.,.{({({(({{{{.,...,|||{|,.,..}}}}))),|.,.,.((((((....)))))).{{{{.((({((,...||.|||{(((((,({(,(({(..,,......,},}|.....{((({{{.|||{(({......)))),,),),,,}}}...,,,|(((((((((((.....{{(,,..........))),......)))))))))))...,)))|||,|,||}}}||||||}},||,||,||,|||,|}}|{.,|,||||}},,|{||}......))))},}}}}}}}..}|}}}}}}},}}}...,},})})})))}))}))),))}....,,,,||||}||}}||||,..,,}}})))))})))}||||||||..{||.{{((.......}}},..||||,}|||||}||,{|(((((..(((((((((.....)))))))))))))}.}..}))}}...}))))))).}}}))}}}}}}}}))}},|}}}}}.|}}|||||||..,,,,,....,{{{{...,{||||{{{{{|{{{{|||||,,,||{{|||{{{.((((......)))).}}},,}}},|||||{.{{{.{{{{{{.,||||.{{.,,)).})))..}|||||,....,{|||||},{..{{,,,|||,|}},,})}}}},})}}.})))}})}})}..|,|{{((({{{.((,(((((,({({,(((((((.((((.((((....)))).)))).))))))).,|{,|||..,})),}}}...,{.{(((..(((....))).)))}.}}})})}.}}.})),|||))))))}}},}.,,}}},,}))}))))}}}}}},)))}}})}))))},}}|}|,..}},.,}}}}},}))}}}||}}}|||||,,}},|)}}},}}}}}},))))})))))|||}}...||}))))),))))))))))}|||||||{,....,.}))}||||||{{{{{,.....).)))),,,|||,.,)))||,))}}))},..,||.||||,||||.,}},,,.,,})))))})))})..,,.,}))))})})))))}}},.{{|{{.{{{{||,,..(((.....))),,)))))}..})))),,}}}},,{{(((((...))))))}|,,,,},..{(({{.{{{,(((.((.{{{{.|{{||...,)))).).))).))))).))).,))))).,)))..))))))))))))}.)))))))))})))))))..)))))))))}.,))))),))}{({.((({...{{.,,,{{{...{{{(((((((((...,,.,{{{..{{((........))))}}}},)))),,))))}|||{{{....,}}},}}|...,..{{|||{{...,{{,,,{{{{{,,,,...,.,,,||,{{{.{{{,,|||,.,..|,|{{....{{{{,{{(({((....,,....,,.....,,....))))})}.{(((((....})))))}}})}),))),,..))))))),,.,}})})})}..,}.)))).})}..(((((((((,.{{((,,,,},,..,...}))))))))|||||.,,,.,}}}}}..,{{.((((({........})))))}...},}))))))))).)))))))))))))).(((((((((.(.(........).))))))))))}))))...(((((((..(((....)))..)))))))..........

Transcripts

ID Sequence Length GC content
ACUGAGUCCCGGGACCCCGGGAGAGCGGUCAAUGUGUGGUCGCUGCGUU… 5833 nt 0.4701
Summary

Vascular endothelial growth factor (VEGF) is a major growth factor for endothelial cells. This gene encodes one of the two receptors of the VEGF. This receptor, known as kinase insert domain receptor, is a type III receptor tyrosine kinase. It functions as the main mediator of VEGF-induced endothelial proliferation, survival, migration, tubular morphogenesis and sprouting. The signalling and trafficking of this receptor are regulated by multiple factors, including Rab GTPase, P2Y purine nucleotide receptor, integrin alphaVbeta3, T-cell protein tyrosine phosphatase, etc.. Mutations of this gene are implicated in infantile capillary hemangiomas. [provided by RefSeq, May 2009] CIViC Summary for KDR Gene

Forensic Context

A study in mice demonstrated that following controlled cortical impact traumatic brain injury, juvenile animals exhibited reduced cortical lesion formation, cell death, and behavioral deficits compared to adults, correlating with enhanced restoration of cerebral blood flow and reduced blood-brain barrier disruption [Brickler et al. DOI:10.1523/JNEUROSCI.0914-18.2018]. A study in rats demonstrated that experimental brain contusion leads to an upregulation of the KDR (Flk-1) mRNA and protein in vessel-like structures adjacent to the lesion from 1 day through 6 days post-injury [Sköld et al. DOI:10.089/neu.2005.22.353].