| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCGCGGAGCACCUGCGCCCGCGGCUGACACCUUCGCUCGCAGUUUGUU… | 1432 nt | 0.4134 |
This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions in the inhibition of phopholipase A2 and cleavage of inositol 1,2-cyclic phosphate to form inositol 1-phosphate. This protein may also play a role in anti-coagulation. [provided by RefSeq, Jul 2008]
A study in humans identified the ANXA3 as a key diagnostic biomarker for burn injury, showing significantly higher expression in both skin and peripheral blood samples from burn patients compared to normal controls [Yang et al. DOI:10.3389/fgene.2021.781589]. A study in humans identified the ANXA3 as one of the top 10 upregulated differentially expressed genes in peripheral blood from myocardial infarction patients compared to healthy controls [Zhao et al. DOI:10.3892/etm.2017.5580]. In a separate study investigating UVB-induced inflammatory pain, the ANXA3 was found to be upregulated in both human and rat skin at the peak of hyperalgesia, with a fold change of 11.8 in humans and 3.8 in rats [Dawes et al. DOI:10.1371/journal.pone.0093338].