Basic Information

Symbol
ANXA3
RNA class
mRNA
Alias
Annexin A3 ANX3 Inositol 1,2-Cyclic Phosphate 2-Phosphohydrolase Placental Anticoagulant Protein III 35-Alpha Calcimedin Lipocortin III Annexin-3 PAP-III Annexin III (Lipocortin III, 1,2-Cyclic-Inositol-Phosphate Phosphodiesterase, Placental Anticoagulant Protein III, Calcimedin 35-Alpha) Annexin III (Lipocortin III) Calcimedin 35-Alpha Annexin III
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_005139.3
Sequence length
1432.0 nt
GC content
0.4134

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-383.30 kcal/mol
Thermodynamic ensemble
Free energy: -413.30 kcal/mol
Frequency: 0.0000
Diversity: 312.47
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((.....))))))..((.(((((..((((.((...(((((.((.(((..............((((((((.((((((..(((((((.((((......)).)).)))))))...)))))).......(((((((((.(((((((((..(...(((..............))).)..)))))))))...)))))))))...(((........))).......))))))))...(((((((......)))))))(((((.(((((....))))))))))...))))))))))...)).))))....)).))).))..(((((..((((((((((((((((((((((((((.((.((..(((((((.((((...)))).)))))))..)).))...)))).((((((((((((((...(.((((...(((((((((...((((..(((((....(.(.((((((((((...............(((((((....((((...(((.((....)).))).))))..((((...))))........)))))))((((..((((((((((((.((..((((((..((((.....((.(.(((((((.((((...((((((((((((((...((((......))))...))))).......(((((((((((((((((((.....(((((((.(((((.(.(((...(((.((((......)))))))...)))).))))).((((....))))..((((((.......))))))...........)))))))..........(((((.....)))))..)))))...))))))))))))))....))).)))))))))).))))))).).))..))))..))))))(((((...(((((.........))).))...))))))).)))))))))))).))))((((((...(((......((((((((((((.....)))...))))))))))))..)))))))))))..))))).).)...)))))....((((.........(((((....)))))......))))((((((............))))))((((((..((.........))...))))))....))))...))))).)))).....)))).)......(((.(((((...........))))).)))....((((...(((((.....((((((...)))))).....))))).))))..........((....(((((.((((((..((((..((((((...)))).))..))))..)))))))))))....)))))))))))).))))..........................)))).)))))....)))))).)))))))..)))))..((((.(((((((.(..........).)))))))))))....
Thermodynamic Ensemble Prediction
.{(((((.{{..},}}))}}||}(((({..((((.((...((({{{({{(((.({...........((((((((,((((((..(((((((.,,((......},.,,,}))))))...)))))).......(((((((((.(((((((((..,...(((...,{......}}.))).}..)))))))))...)))))))))||.(((........))).......))))))))...(((((((......)))))))(((((.(((((....)))))))))).,.))))))))))...)).))))....}},,}).))..(((((..((((((((((((((((((((((((((.((.((..(((((((.((((...)))).)))))))..)).))...)))).((((((((((((((...{{.{{{...,,..,{,.,...,|||}}(((((....(,,.((((((((((..,.....,,.....(((((((....((((...(((.((....)).))).))))..{,,....,},.........)))))))||{{..((((((((((((.{{.,((((,,..,,||}},..((,(.((({(((,((((.{{({{(({...{((((...((((,....,))))...))))}{{{{{..(((((((((((((((((((.....((((,,..{((((.{.(({.{.(((.((((......))))))).,.}))},))))}.{{({....)})},,{,,,,........,}}}}|},.,.,.,...,,))}}{(....},...||{||,.}}}),},...))))),..})))))))))))))....|...,,}))})))).}}}}}},.|{||..,,,)}})))|||({({{...||||{.........))}.)),..))))))).)))))))))))).}}}}((((((...(((,.....{(((((((((((,...,)))...))))))))))))..)))))))))))..))))).),,.,.)))))....,,,...........{(({....)))|{{{,...{{..,,{{{{.,,.........})}|||((((((..{{.........}}...}))))),{{((({{{...})))}))}......)})))),,,...(((.(((((.,,.....,,.))))).))).........,,{{,...,})}{(((({...)))))}.....|||||.......,,......{{....(((((.((((((..((((..((((({...}))).))..))))..)))))))))))....}})))))))))).)))).........................,})))}}}))),...}))))).)))))))..)))))..{{{{.(((((({.(,,,,....,,),)))))))))))....

Transcripts

ID Sequence Length GC content
AGCGCGGAGCACCUGCGCCCGCGGCUGACACCUUCGCUCGCAGUUUGUU… 1432 nt 0.4134
Summary

This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions in the inhibition of phopholipase A2 and cleavage of inositol 1,2-cyclic phosphate to form inositol 1-phosphate. This protein may also play a role in anti-coagulation. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the ANXA3 as a key diagnostic biomarker for burn injury, showing significantly higher expression in both skin and peripheral blood samples from burn patients compared to normal controls [Yang et al. DOI:10.3389/fgene.2021.781589]. A study in humans identified the ANXA3 as one of the top 10 upregulated differentially expressed genes in peripheral blood from myocardial infarction patients compared to healthy controls [Zhao et al. DOI:10.3892/etm.2017.5580]. In a separate study investigating UVB-induced inflammatory pain, the ANXA3 was found to be upregulated in both human and rat skin at the peak of hyperalgesia, with a fold change of 11.8 in humans and 3.8 in rats [Dawes et al. DOI:10.1371/journal.pone.0093338].