Basic Information

Symbol
KIR3DL2
RNA class
mRNA
Alias
Killer Cell Immunoglobulin Like Receptor, Three Ig Domains And Long Cytoplasmic Tail 2 CD158K Nkat4b Nkat4 Killer Cell Immunoglobulin-Like Receptor, Three Domains, Long Cytoplasmic Tail, 2 Killer Cell Immunoglobulin-Like Receptor 3DL2 P70 Natural Killer Cell Receptor Clone CL-5 Natural Killer-Associated Transcript 4 CD158 Antigen-Like Family Member K P70 NK Receptor CL-5 Nkat4a NKAT-4 Cl-5 Killer Cell Immunoglobulin-Like Receptor 2DL2 Killer-Cell Immunoglobulin-Like Receptor P70 Killer Cell Inhibitory Receptor MHC Class I NK Cell Receptor Killer Ig Receptor KIR Antigen 3DL2 CD158k Antigen KIR-3DL2 NKAT4 3DL2 P140
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_006737.4
Sequence length
1877.0 nt
GC content
0.5338

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-602.30 kcal/mol
Thermodynamic ensemble
Free energy: -632.88 kcal/mol
Frequency: 0.0000
Diversity: 582.39
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((((.((.((((....)))))).(((((((((.((....)).)))..)))))).((((((((.........(((((((((..((((......((((((.(((((........))))).))))))))))..))...(((((((((.(((((((..((((((((((((..(((((.....(.((((((.........))))))))).)))..))))).....)))))))..)).)))))...((((........((((((((........(((((...((((((((.(((..((.((....)).))..))).)))).)))))))))...((((((..((((((((.(((.(((((((...((((((.(....(((.(.(((((...................)))))).))))))))))....)))))......((((.((.((((..((((.(((((((.((((((.....)))))).)........((((((.((((((((.(((....)))))))))..(((((((((((((((.(((((((..(((((...)))))........((((((....))))))(((((....)))))...........))))))).)))))))....((((((.........((((........)))).(((((((((..(((.....(((((..........((.((((((((..(((.(((((.......)))))..))).)))))))).)))))))((((..(.(((((...))))).)...)))).....))).)))))))))..)))))).......)))).)))))).)))))).(((...)))......)))))).))))..)))).)))))))))))..))))))))..)))))).((.((((((((..(((.(.....).)))..((...))(((.(((((........)))))))).(((((.((((((.....(((..((..(.....)..))..)))....)))))).))))).........)))))))).))......((((((((.((((.(((((.....)))).((((..((.(((((((((((((.((((.((((((.....(((..((.(((((((...((....))..)))..)))).))..)))....)))))).)))).)).))...)).))))...))).))..))))......((((((..(((..((((.((((((((((((..(((((.......)))))..)))).(((((....)).))).................))).)))))))))..)))..))))))....((((((((((((((((..((((((((((((((.((((.(((.......)))))))...))))......))))))))))....(((.........)))(((((..(.((....)).)..)))))))).)))))..))).)))))..........(((((.......)))))......).)))).))))))))..))))))))........))))..))).)))))).....(((((((((...........))))))..)))...(((((.........))))).)))))))..........)))))))).((((........))))......))))))))....(((((((((.....................((((((...))))))...((((((..........))))))...............((((.......((......))........))))...(((....)))......(((((((.....)))))))))))))))).............................)))))..
Thermodynamic Ensemble Prediction
(((((({((((((((((,.((({(({{{((,{{{{{{,{{{.,|,,.,}|,,}}}})),)}}}||||||{......}}}.|||||||}|},((((......((((((.(((((........))))).)))))))))),,|,{({(((((({,.{(({{{((({(({((({,,,||,}|||},},.},|{((((((.........|||,||{{|{,,...|||||..{{{}},,,}))},..))))).}})))))),.....{((((((((((.(((.((((({((((((((.,.{(((.{{(((((..,,.|,{.{{{.{(({{....})))}}}}}|,....(((((((,,..,)}}}}}),....||||||||.....||}}}}}||........,......,{{,{{{{|(((((.....))))}.,|,|||....||||||.|,.,{}|.,|}}}...{(((.((((((,(((.((((((..((((...{((((....{,((((((.(({...,|}}))))))..{{{,,{{,((({(((,(({{{{{{||||{{.|{|||}|........{(({{|....})))))({(({,...)}))).,||.......}}}}})).))))}}},...,{{((({.....{,,({,({{..{{{{|||,.{((((((((..({(....,((({(.....,,,..((.((((((((,.(((.(((((.......)))))..))).)))))))).))}}}))||||.}|,{((({...)))))...,,)))}.....}},.))))))))){{||||||{...{{{|{{|{|||{,,.{|||||.((({{{|{||..,.,.......,,|,..}}}},.,,},})))).)))},}}.((((((((((((....{,....,.)).)))))))))).,..}|}}})}||(.(((((........)))))))).(((((.((((((....,(((..((..{.....)..))..)))....)))))).))))).(({,{((.{{.{{.(((((....))))).}},),))))))((((.....))))....,,,|.|}}}|,,{||}|}}}||{{,..{{{.,,,|}||}||{|,|{|}}}.....|...||}|||}},,.}}}..}}}))}..),))))))})))).))})..}))))),))}}})))}.))}}.,.......((((((..(((..((((.((((((((((((..(((((.......)))))..)))).(((((....}).)))....,............))).)))))))))..)))..))))))....,,.}.)))))))}...)))),.})))))))))}))}|}}}}}}}}}.{(((...((((((({.....{{((|||{|.,.,,,.||}}},.....,,||||,.{{{,,,,,.{|,,,,.{||{.|||.,}||,.((((((..((..(((....(((((...{.((....{{.......))....)).,...)))))....)))..))..)))))).|||,..}}})}))}}(({((((((...........))))))..)))...(((((.........))))).,)))))))).)))}....)))).||,(({{.......,)))}......|||||||,....{((((((((,,........,,,........((((((...))))))...((((((..........))))))...............((((.......,,......}}........))))...(((....)))......(((((((.....))))))),,))))))),},...,......................))))}..

Transcripts

ID Sequence Length GC content
GGGGCGCGGCCUCCUGUCUGCACCGGCAGCACCAUGUCGCUCACGGUCG… 1826 nt 0.5350
GGGGCGCGGCCUCCUGUCUGCACCGGCAGCACCAUGUCGCUCACGGUCG… 1877 nt 0.5338
Summary

Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. This gene is one of the "framework" loci that is present on all haplotypes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2011]

Forensic Context

No relevant information is available at the moment.