| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCUAGGUGCAGCUGCCGGAUCCUUCAGCGUCUGCAUCUCGGCGUCGC… | 1638 nt | 0.4335 |
The Annexin 5 gene spans 29 kb containing 13 exons, and encodes a single transcript of approximately 1.6 kb and a protein product with a molecular weight of about 35 kDa.The protein encoded by this gene belongs to the annexin family of calcium-dependent phospholipid binding proteins some of which have been implicated in membrane-related events along exocytotic and endocytotic pathways. Annexin 5 is a phospholipase A2 and protein kinase C inhibitory protein with calcium channel activity and a potential role in cellular signal transduction, inflammation, growth and differentiation. Annexin 5 has also been described as placental anticoagulant protein I, vascular anticoagulant-alpha, endonexin II, lipocortin V, placental protein 4 and anchorin CII. Polymorphisms in this gene have been implicated in various obstetric complications. [provided by RefSeq, Dec 2019]
A study in male BALB/c mice demonstrated that dietary methylmercury exposure altered hippocampal protein and RNA expression, with ANXA5 ANXA5 identified as differentially expressed in ANOVA for both protein and RNA, though it was not significant in post-hoc two-group comparisons [Mellingen et al. DOI:10.1093/Mtomcs/Mfab022].