Basic Information

Symbol
ANXA5
RNA class
mRNA
Alias
Annexin A5 CPB-I PAP-I Placental Anticoagulant Protein I Vascular Anticoagulant-Alpha Calphobindin I Endonexin II Annexin V VAC-Alph RPRGL3 ANX5 ENX2 Placental Anticoagulant Protein 4 Thromboplastin Inhibitor Anchorin CII Lipocortin V VAC-Alpha Annexin-5 PP4 Epididymis Secretory Protein Li 7 HEL-S-7 CBP-I
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_001154.4
Sequence length
1638.0 nt
GC content
0.4335

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-444.90 kcal/mol
Thermodynamic ensemble
Free energy: -477.80 kcal/mol
Frequency: 0.0000
Diversity: 432.45
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((.((((((((.(((..((....)).))).)))))))).)))(((.((((((....(((((.(((((((((..((((((((((((((....(((((......)))))..((((.(((((((((((.......((((.((((.((....)))).))..))))......))))))..).)))))))).))))))....)).))))))(((((.(((......((((((.(((((......)))))....((((((.((((.....)))).).))))).......))))))...)))))))).((((((.(((((((((((............)))..)))))))).))))))..........((((((.(((.......(((((...))))).....))).)))))).........((((.(((((((...))))))))))).............)))))))))................((..(((.........(((((.((...)))))))......(((((((.......((((........)))))))))))....)))..)).)))))..)))))))))..((((((.....((((((....))))))(((((.((((((((((((.((((...((...(((.((...(((((((((..(((..........)))..))))))))))).)))...))..(((((((((((.(((((((((......)))))).....(((((.....)))))))).)))))))))))...(((.((((.((((.............(((((((((.(((.((....((....(((.(((((.......((........))........))))).)))))....)).))).)))))...)))).....)))))))).))))))).))).))).)))))))))))(((((.(((((........)))))((((((((((((((.(((..((((.....((((.((((.((((((..((((.((((((((((....((.(((.((.(((.(((.(((((.(((((((...((..(((((.............((((((.(........).))))))((((......))))((((((.....))))))..((((....))))..))))).)).)))))))((((.......))))(((..((((((.((((.....................)))).))))))..)))..............))))).)))..))).)).))))))))))))))).))))(((((((.......((((......(((((......)))))....))))(((.((.....)).)))....................((((..(((((((((((.....)))))))))))..)))).)))))))....((((....)))))).))))...)))).))))..)))).))).))))))))).))))).(((((((((.(((((..((((...))))..)))))................(((......)))..................))))))))))))))))))))........((((.(((...((((((((....))))))))....))))))).
Thermodynamic Ensemble Prediction
.(((.((((((((.(((.,((....)).))).)))))))).)))(((.((((((,{,.((((,,(((((({{(,.((((((((((((((....(((((......)))))..{(((,(((,{{(((((,,,....,,{|,{{||,||.},,}}}}.))|.}}|||,.,,,|}))}||.},)})})}}|.))))))....}}.))))))(((((.(((......((((((.(((((......))))),..,((((((.((((.....)))).).))))).,.}...))))))...)))))))).((((((.(((((((({((............))}..)))))))).)))))).....,,...|{||||.|||.,.,,,.,{{{,....,,}}....}))},)))))},...,,.,,((((.(((((({...})))))))))).....}||,|},,))))))})}.............,..,{..|||.......,.(((({|({...)})))))...,..(((((((.......,{{{........,,,,))))))).}}})})}.,),))))))))))))))}|,.(((((({.{((((((((....))))))))|{(,((((((((((((.((((..{({,,.{((,({...{((((((((..(((..........)))..)))))))))))}))).,}}}..(((((((((((.(((((((((......)))))).....(((((.....)))))))).)))))))))))...(((.((((.(((({,,,,,,.{,,.||,(({(((({..,,,,{{|,.,|,,{{.{,({,({...,)),)),.,.,,,{({{{,......}})},})},)}}}}})}....,.,|},...,||,.,,.}))))))).))))))).))).))).))))))))},.{((((,(((((........)))))((((((((((((((.(((..((((.,...((((.((((.((((((..(((({({((((((({....(((({({(({((,,(({.,,|||.|||||||...{{..(((((..........,,,((((((.(,.,.,...),)))))}((((......))))((((((.....))))))..({((....}))),,))))).}}.}}}}}},((((.......)))){{{..((((((.((((...........,.........}))).))))))..|||,,............))))).))},,,,..,)}))))}))))))))||{||||.,,||||}}}..,.,||{.,,,..(((((......)))))....}},,,,,,||...,.|,.|||..,,,..}},..........,{((..(((((((((((,...,)))))))))))..))))})))),,,....,{{{....)))})).))))...)))).)))).,)))).))).)))))))))}})))).{((((((((.{((((..((({...))))..))))}..........,{,,,,{||,,....|}}....,,,..,,.......))))))))))))))))))))........((((.(((...((((((((....))))))))....))))))).

Transcripts

ID Sequence Length GC content
AGUCUAGGUGCAGCUGCCGGAUCCUUCAGCGUCUGCAUCUCGGCGUCGC… 1638 nt 0.4335
Summary

The Annexin 5 gene spans 29 kb containing 13 exons, and encodes a single transcript of approximately 1.6 kb and a protein product with a molecular weight of about 35 kDa.The protein encoded by this gene belongs to the annexin family of calcium-dependent phospholipid binding proteins some of which have been implicated in membrane-related events along exocytotic and endocytotic pathways. Annexin 5 is a phospholipase A2 and protein kinase C inhibitory protein with calcium channel activity and a potential role in cellular signal transduction, inflammation, growth and differentiation. Annexin 5 has also been described as placental anticoagulant protein I, vascular anticoagulant-alpha, endonexin II, lipocortin V, placental protein 4 and anchorin CII. Polymorphisms in this gene have been implicated in various obstetric complications. [provided by RefSeq, Dec 2019]

Forensic Context

A study in male BALB/c mice demonstrated that dietary methylmercury exposure altered hippocampal protein and RNA expression, with ANXA5 ANXA5 identified as differentially expressed in ANOVA for both protein and RNA, though it was not significant in post-hoc two-group comparisons [Mellingen et al. DOI:10.1093/Mtomcs/Mfab022].