Basic Information

Symbol
KLF2
RNA class
mRNA
Alias
KLF Transcription Factor 2 LKLF Kruppel-Like Factor 2 (Lung) Lung Krueppel-Like Factor Lung Kruppel-Like Factor Krueppel-Like Factor 2 Kruppel Like Factor 2 Lung Kruppel-Like Zinc Finger Transcription Factor Kruppel-Like Factor LKLF
Location (GRCh38)
Forensic tag(s)
Sudden death from CNS diseases

MANE select

Transcript ID
NM_016270.4
Sequence length
2820.0 nt
GC content
0.6117

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1135.30 kcal/mol
Thermodynamic ensemble
Free energy: -1183.24 kcal/mol
Frequency: 0.0000
Diversity: 789.39
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((....((......))(((((((....(((((..(((((((((((...(((((((((..((((..((((...((...(((((...(((((.(((((((.((............(((((((..(((((...((((..((....)).))))((((((((.((......)).))))))))((((.((....)).))))((((((................).)))))((((........)))).)))))..))))))))).))))))).))))).)))))((((((((((((((.((..(((((((((((((.........))))..(((((..............)))))...)))))))))..))...(((.((.(.((((.(((.(((.((.....))))).)))..))))).)).)))(((((((..(..(((.(.(((.((((....))))..))).).)))..).))))))).))))))))))))))..((((((((.((((((....)))).))...))))))))....(((((.(((.(((..((((..((((((...((((..(((.((...((((((....))))))))..)))..).)))...))))))..))))....)))))).)))))..(((.(.((((((...(((((((.....((.((((((....))))))...))....)))))))))))))).)))..((.....))((((((((.((((...(((..((((((((.((......))(((((.((((((((((...(((((.((((((...((((.(((((((((........))).((.(((....))).))((((((.((.(((((((....((((.(....))))))))))))))((....))................))))))..)))))).))))...............(((((((..(((((..(((((..(((....)))....(((.....)))((.((((((((.(((...))).))))).))).))..)))))..))))))))))))..))))))...............((((..(((((.((....(((((.((((((((...(((((...(((.....)))......))))))))))).))...)))))..)).)))))...))))..))))).)))).)))))).)))))((((((.....(((((.(((((............))))).))))).......)))))))))).))))))).)))).))).)))))....(((((...))))))).))))..))))..))))))((((.((((((..((.((((((.....(((((((((((((.((((((((........(((((..((((((.....)))))).)).)))........))))..))))...))))))))))))).))).)))))...(((((........((((((.....))))))))))).(((((((((((.(((((.(((......))).))))).))))).....))))))..(((((....)))))....((..(((((((.(.......).)))))))..))................)))))).)))).((((((((((.....(((........)))))))))))))..........))).)))))))))))..)))))...)))))))....((((((((((((((((((.(((......((((((....((((((...((((...))))))))))((((((.((((...(((.((((.(((..((((..((((((((((.((((((((((....)))..)))))........(((.(.(((((((.......(((((((.....((((.((((........)))).))))...))))))).(((((....)))))))))))).)))).....(((((((......)))))))..................(((((((.((.((..(((((((.(((....))).......((((((....)))))).....................((.(((....))).))(((((((..(((((....((((((..........(((.........))).........((((......)))).(((((....)))))..(((......))).....)))))))))))..))))))).(((((......))))))))))))))))))))))))))))))(((((((((((.((........)).)))))...(((((....((((((((((........(((((((((.((((((((((..(((((.(.(((.....))).))))))))))))).((((((((((((..((((..((((((((..(((......(((.(((((.....))))))))....((((..(((....))).))))...))).)))))))).........(((........)))...))))..))))))...))))))...(((.......)))..))).))).))))))......)))))))))).)))))......)))))).......)))))))))..)))...((((...........((((((...))))))..........)))))))).)))..)))).)).))))..))))))))).)))).)))))))))))))).....)))))....(((....)))....(((((....(((.((..(((((((...(((.((.((((....)))))).))).))))).....))..)).)))..)))))......
Thermodynamic Ensemble Prediction
...,,(({((....({..,,,.|,(((((((...{(((((..(((((((((((...((((((((,..((((.,((((...{{...(((((...(((((.(((((((.((............(((((((..(((((...((((..((....)).))))((((((((.((......)).))))))))((((.((....)).)))){(((({,..{,.....,}....).))))|((((........)))),)))))..))))))))).))))))).))))).))))){(((((((({((,(,,(,,(,,(((((.(((({......{{|,,|{{((((((..{{((({...,.{|({{.,{|{(((({(|..(({{{{...((.,.,||,.{(({,(({(,{{{.{|{|||{|||{{{{...{{{.{{(((((,,,..{|.(({{{{((,,(((({{.{|||,..|||{|.|||..{,|||||||.|||||||||||||,..((((((((.((((((....)))).))...))))))))....{{({(.((({((({{((((,.{(((((...{{||.,||{.||,}}||||||.,}}))})))))))))),,}.,,}.,,))))))},)}}}.,..))))}}{||||}.,{{{{|.((((((...(((((((.....((.((((((....))))))...))....))))))))))))).)))},.||}....))||||{|{|}|||,,,,{{(.,(((((,,,.,|,.,.,|||((||,.{|{|||(({({,,{((((..((((.....}))))})}|,(((((.....{((.{(({((({....{{{|,((,((,,((.(((,..({...,(((,({{{,},}},,,))))).)||....))...}}}.,...,,.}}})))),}))))))).)))}..})}}}........|{|{{{{{{{{{(,,{({((.,,,}|||.,,,...,,|||}.},.}||}}.|,..,||,,||))}.}}))))))))||{.(((..((((((((....))))....)))).))).))}...)}}..)))))).})))){{{..((((((({..{(,|{(,,,((((......)}))..}),.)}..)))))))).,.}}}....))).))),)})))))),))))...)})))}))))},),))),)))))|||,,,..}}}|||||),,|||............,}},}.||||}.......)),,)))))))))))))),)))}.),)})))))....(((((...)))))}}.))}),})})).,)}}},,((((.((((((..,{,((({{{..{{.(((((((((((((.((((((((........((({(..((((((.....)))))).}}.)))........))))..))))...))))))))))))).)),.}}}}),.,(((((.......}||||{(.....}}}}))}}}},.,{{{{{{(({(.{({((,({{...,,,|}}.}}}}}.}|}}}|....|}}},}..|||{{...,))))},||.((,.(((((((.(.......).)))))))..)).},,},,,.,},....)))))).)))).(((((((({,...,{(((........))))))))))))).....}))}}))).)))))))))))..))))),}.)))))))...,((((((((((((((((((.(((......((((({....((((((...((((...))))))))))((({((.((((.,.(((.((((.(((..((((.,{(((((((((,({{(({{{((.,..))),},||||......|,|{{.{.({{{({{.,.....(((((((...,.((((.((((........)))).))))..,))))))}.(((({....)))))})))))).)))}....,(((((((......))))))),................,(((((({,((.((..(((((((.(((....))).,,....((((((....)))))).,..,......,,,....,,,{(.(((....))).)}(((((((..(((((....((((((...,,{...,||....{{{{{{{,.....,,...((((......)))).,,,||}}},}}|||..{{{......)))..,,,)))))))))))..))))))).(((((......)))))))))))))))))))))))),)))))(((((((((((.(({(,...}})),))))}{,,(({{,{,..((((((((((........(((((((((.((((((((((,.{((((.(.(((.....))).)))))))))))))}((((((((((((..((((..((((((((..(((......,((,(((((.....}))))),}}},.((((..(((....))).))))...))).)))))))).........{{{,,,.....)))...))))..))))))...))))))...(((.......)))..,)).))).))))))......)))))))))).}))}}..,,.,))))))..}}...))))}})))..)))...((((...........((((((...))))))..........)))))))).))),.)))).)).)))}..})))))))).)))).)))))))))))))).,....,))).||..{|,...}}))}}.{((((,,,{({{..{{...((({{...(({.,,.((({....,}))}).))}.})))).},.,,}.,},.})),,)))))......

Transcripts

ID Sequence Length GC content
ACAGAGCCGUCCCCGCCCGCCCGCGCCCCGACCAGCCCGGCCUCGGGCA… 2820 nt 0.6117
Summary

This gene encodes a protein that belongs to the Kruppel family of transcription factors. The encoded zinc finger protein is expressed early in mammalian development and is found in many different cell types. The protein acts to bind the CACCC box found in the promoter of target genes to activate their transcription. It plays a role in many processes during development and disease including adipogenesis, embryonic erythropoiesis, epithelial integrity, inflammation and t-cell viability. [provided by RefSeq, Mar 2017] CIViC Summary for KLF2 Gene

Forensic Context

A study in domestic swine demonstrated that the KLF2 was mentioned in the discussion as protective against ischemic stroke, though it was not experimentally studied in the myocardial infarction model [Kaikkonen et al. DOI:10.1161/CIRCGENETICS.117.001702]. In a mouse model of traumatic brain injury, the KLF2 exhibited reduced mRNA expression in whole blood monocytes from clodronate pre-treated, injured mice, indicating its role in monocyte conversion and pro-inflammatory responses [Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8].