| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUUCCUCCACCUGCUGGCCCCUGGACACCUCUGUCACCAUGUGGUUCC… | 876 nt | 0.5731 |
Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. This protein is functionally conserved in its capacity to release the vasoactive peptide, Lys-bradykinin, from low molecular weight kininogen. [provided by RefSeq, Jul 2008]
A study in porcine skin exposed to bromine vapor demonstrated that the KLK1 transcript was significantly downregulated, with a 5.28-fold decrease after a 10-minute exposure and a 2.93-fold decrease after a 20-minute exposure, as identified via microarray analysis [Rogers et al. DOI:10.1002/jbt.20383]. A study in zebrafish and mouse demonstrated that the KLK1 transcript, a kallikrein 1-related peptidase, increased in abundance within 1 hour postmortem in mouse brain and liver tissues [Pozhitkov et al. DOI:10.1098/rsob.160267]. The research identified 1063 genes with significantly increased transcript abundances after death, functionally categorized into stress, immunity, inflammation, apoptosis, transport, development, epigenetic regulation, and cancer, indicating a step-wise shutdown process.