Basic Information
MANE select
Secondary Structure
Secondary structure that contributes a minimum of free energy.
Thermodynamic properties of the Boltzmann ensemble.
Structure Prediction
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAACUCACCACCUGGCCGUGGACACCUGUGUCAGCAUGUGGGACCUGGU… | 2866 nt | 0.5115 | |
| AAACUCACCACCUGGCCGUGGACACCUGUGUCAGCAUGUGGGACCUGGU… | 2669 nt | 0.5054 | |
| AAACUCACCACCUGGCCGUGGACACCUGUGUCAGCAUGUGGGACCUGGU… | 2829 nt | 0.5111 |
Summary
This gene encodes a member of the grandular kallikrein protein family. Kallikreins are a subgroup of serine proteases that are clustered on chromosome 19. Members of this family are involved in a diverse array of biological functions. The protein encoded by this gene is a highly active trypsin-like serine protease that selectively cleaves at arginine residues. This protein is primarily expressed in prostatic tissue and is responsible for cleaving pro-prostate-specific antigen into its enzymatically active form. This gene is highly expressed in prostate tumor cells and may be a prognostic maker for prostate cancer risk. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Jan 2012]
Forensic Context
A study in humans demonstrated that the KLK2 is a specific mRNA marker for seminal fluid detection, present in all tested semen samples including azoospermic samples with no observed cross-reactions with non-target body fluids [Albani & Fleming DOI:10.1016/j.scijus.2017.09.002]. In a subsequent developmental validation of a multiplex RT-PCR system, the KLK2 was included in a pentaplex assay for semen and seminal fluid, where it demonstrated a lower limit of detection of approximately 0.05 µL for semen and was successfully detected in post-coital vaginal swabs for up to six days [Albani & Fleming DOI:10.1016/j.scijus.2019.01.001]. A study in humans demonstrated that the KLK2 is a highly specific mRNA marker for seminal fluid identification, with minor to no off-target expression [Lynch & Fleming DOI:10.1016/j.scijus.2023.10.004]. Further research applied machine learning models to RT-qPCR data, where the KLK2 was used alongside other targets to discriminate body fluids, with Multinomial Logistic Regression achieving an overall accuracy of approximately 0.95 [Lynch et al. DOI:10.1016/j.forsciint.2024.112032].