| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCCCCAAGCUUACCACCUGCACCCGGAGAGCUGUGUCACCAUGUGGGU… | 1906 nt | 0.5551 | |
| AGCCCCAAGCUUACCACCUGCACCCGGAGAGCUGUGUCACCAUGUGGGU… | 1335 nt | 0.5498 | |
| AGCCCCAAGCUUACCACCUGCACCCGGAGAGCUGUGUCACCAUGUGGGU… | 1464 nt | 0.5485 |
Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. The gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. It encodes a single-chain glycoprotein, a protease which is synthesized in the epithelial cells of the prostate gland, and is present in seminal plasma. It is thought to function normally in the liquefaction of seminal coagulum, presumably by hydrolysis of the high molecular mass seminal vesicle protein. The serum level of this protein, called PSA in the clinical setting, is useful in the diagnosis and monitoring of prostatic carcinoma. Alternate splicing of this gene generates several transcript variants encoding different isoforms. [provided by RefSeq, Dec 2019]
A study in humans demonstrated that the KLK3 mRNA marker, which encodes prostate-specific antigen, is a highly effective and specific marker for semen identification, showing over 98% positive detection in both normal and infertile semen samples with minimal cross-reactivity in non-semen body fluids [Tian et al. DOI: 10.1002/elps.202000238]. The broader literature review confirms the KLK3 is a pivotal mRNA marker for body fluid identification, noted for its high specificity and stability in forensic applications [Liu et al. DOI: 10.1002/elps.202400077]. A study in humans demonstrated that the KLK3 is a semen-specific mRNA marker used in multiplex RT-PCR assays for forensic body fluid identification [Akutsu et al. DOI:10.1016/j.legalmed.2022.102087]. In a separate validation study, the KLK3 was integrated into an mRNA multiplex assay for casework, where it showed lower sensitivity compared to other semen markers in dilution and mixture experiments but was frequently detected in actual forensic casework samples [Bamberg et al. DOI:10.1016/j.fsigen.2021.102542].