Basic Information

Symbol
KLK4
RNA class
mRNA
Alias
Kallikrein Related Peptidase 4 KLK-L1 EMSP1 PSTS Enamel Matrix Serine Proteinase 1 PRSS17 EMSP Kallikrein-Like Protein 1 Serine Protease 17 Kallikrein-4 Prostase Kallikrein 4 (Prostase, Enamel Matrix, Prostate) Enamel Matrix Serine Protease 1 Androgen-Regulated Message 1 EC 3.4.21.- Kallikrein EC 3.4.21 AI2A1 ARM1
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Mixture deconvolution

MANE select

Transcript ID
NM_004917.5
Sequence length
1416.0 nt
GC content
0.6130

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-493.70 kcal/mol
Thermodynamic ensemble
Free energy: -516.50 kcal/mol
Frequency: 0.0000
Diversity: 348.99
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((..(((((.((...))))))).(((.....((((((.....(((((((.((((.(((..(((.....)))..))).)...))).((((((((..(((((...(((((.....(((.(((...(((..(((((....(((..(((((((((...((......))...)).))))))))))....)).)))...((.(((.(((...((((.((((.........((((((..((((((..((((.((((((.....))))))..)))).)))...)))....))))))............((((((((.......(((..(((((.((.....((((.((((.(((..((((.(((((....)))))))))..))).................)))).)))).....)).))))).))).......(((((((......)))))))(((((.(((....(((((((.......)))))))..))).......((((((........))))))....(((((((((((((((.....))))))).(((((.((..((((..(((((.((((((((.((.((((....((..((((...((......))..))))..))....)))))).))))))))))))))))))).))))).........(((((((((....(((......(((((((....((((((....((((..((((((((.((((.(((...(((.......)))...))))))).(((....)))((((....))))...)))))))).....(((((.(((..(((....((.....)).(((......)))(((.((((((((((.((((.((...((.((.........)).))...)).)))))).......)))))))))))))).))))))))))))(((((....(((.....))).)))))((((.......))))..))))))....))))).))........)))))))))))).....)))))))).(((((...((.((...(((((........)))))...)).))...)))))..)))))..))))))))(((((...((.((...(((((........)))))...)).))...))))))))))))).....))))))))............((((((...((((....(((.((..((.....))...)).)))...))))....))))))...)))...))))))))))))))))..))))))))..........((((....))))....))))))).....)).))))..))).(((((.......))))))))).))((((.......))))(((((((...((((((..((.((.....))...))..)))))).....)))))))...
Thermodynamic Ensemble Prediction
.,((,((..(((((.((...))))))).(((,....{{((((.....(((((((.(((({(((..{((,.,,.},}..}||{,...,)}.((((((((..((((({..{((({.....(((.(((..,(({..(((((..,.(((..(((((((((...{{......}}...)).)))))))}}}....)).))).,.((.(((.(((...((((.((((.........{||{{(,,,((({(,.((((,(({{{{{,.,||}|}||..}})).})).,.}})....)))}}}............((((((((,{{{...,(({.(((((.((.....((((.{(((.(((..((((.(((((....)))))))))..))).,,,.,.{{........)})).)))).....)).))))},|||,..,,{.(((((({......})))))),|,|||,.,....,{|||||,..(((((((..,)))))))......((((((........))))))....(((((((((((((((.....))))))).(((((.((,,{{{{..(((((.((((((((.(({((((.,..((..((((.,.{{....,,,}..))))..)),,,,)))),}.))))))))))))))))))).))))).........(((((((((....(((({....(((((((....((((((....((((..((((((((.((((.(((...(((.......)))...))))))).(((....))}((((....))))...)})))))}.....(((((.(((.,(((...,({.....})|{,|,,..,,))|(((.((((((((,{.((,,.(({...,.|,......{{{{,.,,.}))}.}))))}.......)))))))))))),,.))))))))))))(((((....(((.....))).)))))((((.......))))..))))))....))))),)}....}),.,))))))))))).....)))))))).{{{{{...{{.||...{((((........))))}...}}.}}...))))).,))))).,))})))}}(((((...((.((...(((((........)))))...)).))...))))))))))))).....))))))))..,....}},..((((((...((((....,,,,{{,.,,.....,.....)})),...))))....))))))...,},...}}}}}}))))))))))..))))))))....,,.,,.{{{{,,,,)}))....))))))).....)))),})..}|}.(((((,....}.))))),,}|,,(((((.......))))).,,.,|......|||...{{((.,.(((((...........))))).),))})}}}.

Transcripts

ID Sequence Length GC content
AUGGCCACAGCAGGAAAUCCCUGGGGCUGGUUCCUGGGGUACCUCAUCC… 1360 nt 0.6096
AGGCAGCAGGCUGGAGCUCAGCCCAGCAGUGGAAUCCAGGAGCCCAGAG… 1416 nt 0.6130
Summary

Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In some tissues its expression is hormonally regulated. The expression pattern of a similar mouse protein in murine developing teeth supports a role for the protein in the degradation of enamel proteins. Several transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Dec 2014]

Forensic Context

A study in humans developed a massively parallel sequencing assay targeting coding region SNPs in body fluid-specific mRNAs to deconvolute mixtures, successfully identifying the origin and donor of blood, saliva, semen, vaginal secretion, and menstrual blood components in laboratory-generated and mock case mixtures [Liu et al. DOI:10.1016/j.fsigen.2024.103066]. A study in humans demonstrated that the KLK4 mRNA is a highly specific marker for semen identification using Real-Time PCR assays, showing no cross-reactivity from blood, vaginal secretion, saliva, or female urine [Nussbaumer et al. DOI:10.1016/j.forsciint.2005.10.009]. The analysis of cell-specific mRNA expression, including the KLK4, represents a molecular technique for body fluid identification that supplements DNA analysis in forensic cases [Bauer DOI:10.1016/j.fsigen.2006.11.002].