Basic Information

Symbol
KLRB1
RNA class
mRNA
Alias
Killer Cell Lectin Like Receptor B1 NKR-P1A CLEC5B Natural Killer Cell Surface Protein P1A HNKR-P1A NKR-P1 CD161 Killer Cell Lectin-Like Receptor Subfamily B, Member 1 Killer Cell Lectin-Like Receptor Subfamily B Member 1 C-Type Lectin Domain Family 5 Member B NKRP1A NKR CD161 Antigen HNKR-P1a
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_002258.3
Sequence length
1478.0 nt
GC content
0.3924

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-366.20 kcal/mol
Thermodynamic ensemble
Free energy: -396.21 kcal/mol
Frequency: 0.0000
Diversity: 356.82
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((.......((((......)))).((.(((....))).))..(((((...((((.((((((((...(((.((......))((((.....))))(((((.............))))).))).)))).(((((((......((((((......))))))..((((((((....))))))))(((........))).......(((((.(((..((((((((((((((((((.((((((((((........)))))))))).))............................((((((((((.....((((.((((..............(((((((...)))))))...(((((.........)))))...(((...)))...))))))))....)).)))))))).......((((((((((((...)))).)))))))).....((((..(((.....))).)))))))))))))).))).)))..).)))))))...((((((.(((((((((((....)))))))((((......))))..))))))))))..))))))))))))))).)))))(((((.(((((((.((((((....)))))).))))))).)).)))..........((.((((((......(((((....)))))......)))))).))((((((((.(((((((((.(((.......)))((........))((((((((((.((......((.((........)).))......)).))))))).))).))))..))))).)))))))).((((.(((.((......)))))))))......(((((((.....)))))))...((((((..((((((((..((((....))))....)))..))))))))))).......................(((((((...(((..(((((((.((((((.....))))))........(((((((.....(((.((((((((((((((((.......((((((((...)))))))).(((((((((....)))))))))...(((........))).....((((((((......).)))))))....(((((....)))))((((.....((((.(((((((...(((((((..((((((.........))))))....((((....)))).(((((.(((.((..((((.......(((((((.............))))))).......))))..)).....))).)))))..........)))))))...)))............))))..))))....)))))))))).)))))))))))))....)))))))..(((((((...((((...........))))))))))).)))))))..))).((((......)))))))))))...)).)))))).((((((((((..........)))))))))).
Thermodynamic Ensemble Prediction
..{(((((,({{{{((.,,,.}}}}}}}|||{({.{((,,..},,.,,{{((((({,.{{,..,{{{,,,(,,,{,,.,|}},...,.((((.....))))|,|||,,}}},....{{{|||||{|||,|||,.(((({{{......((((((......))))))..{{((((((,...,}||||||.,,....}}}}})}.....,,(((((.{{|,{((((((((((((((((((.((((((((((........)))))))))).))...............,,....,......((((((((({.....((({{((((,.............(((((((...)))))))...(((((,{,....,})))))...{{{...}}}...))))))))....}},)))))))},,.....||((((((((({,..{|||{||,||,,....,,,}}}.}}}}..}))).)})))))))))))))).)))},))}.}.}})))))...((((((.(((({((((((,,,,}}}}}})||||}.....,,}}..))))))))))..,}}}}}||||}||||{,|,||((((,{((((({,.((((((....,})))}.)))))},.,,.,}}..,}}},,.}||}||,|,|}}},.,{{{{{....)))))...,}})))),)})}((((((((.(((((((((.{((.......))},,........}}{{{(((((((.{(......((.((........)).))......)).))))))).)}}.))))..))))).)))))))).((({.{{{.{{.....,}))))}))),.....(((((((.....)))))))...((((((..{(((((((.,((((....)))}..,.))}..})))))))))),,,,...................(((((((,..{((,,(((((((.((((((.....))))))..,{,...,((((((.....(((.((((((((((((((((.......((((((({...}))))))).(((((((((....))))))))){({({,{{{({{{{{{{,,...((((((((......).))))))),...(((((....)))))..,,..,(((((({{((((({{.{,,(({.,..,,,|||..,...}}})))))}....||||},..}}}}.,||((.|((|{|,,|,,...,{,..,((((((.............))))))),,.....,},.,,)}...,.}},.,||||,..,.,.{{((.,....,.)))}...,..},}}}|.....,,,,}.,}}))},)))))).)))))))))),)}....))))))),}|((((((...((((...........))))))))))}.}))))))..}}}.,{|{,,....)))))))))))...,,.)))))}.((((((((((..........)))))))))).

Transcripts

ID Sequence Length GC content
CCUUUUGCUGAUUUUGCCUCACAGAAUUGAGAGUUUGUUCUUACACACA… 1478 nt 0.3924
Summary

Natural killer (NK) cells are lymphocytes that mediate cytotoxicity and secrete cytokines after immune stimulation. Several genes of the C-type lectin superfamily, including the rodent NKRP1 family of glycoproteins, are expressed by NK cells and may be involved in the regulation of NK cell function. The KLRB1 protein contains an extracellular domain with several motifs characteristic of C-type lectins, a transmembrane domain, and a cytoplasmic domain. The KLRB1 protein is classified as a type II membrane protein because it has an external C terminus. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the KLRB1 as one of ten key hub genes with higher expression in healthy controls compared to sepsis patients, classifying it as a potential diagnostic biomarker for sepsis [Li et al. DOI:10.3389/fimmu.2024.1445858]. Another human study, employing machine learning, identified the KLRB1 as one of the top three important genes for an XGBoost model in sepsis diagnosis via SHAP analysis [Shi et al. DOI:10.3389/fimmu.2025.1640425].