| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUUUUGCUGAUUUUGCCUCACAGAAUUGAGAGUUUGUUCUUACACACA… | 1478 nt | 0.3924 |
Natural killer (NK) cells are lymphocytes that mediate cytotoxicity and secrete cytokines after immune stimulation. Several genes of the C-type lectin superfamily, including the rodent NKRP1 family of glycoproteins, are expressed by NK cells and may be involved in the regulation of NK cell function. The KLRB1 protein contains an extracellular domain with several motifs characteristic of C-type lectins, a transmembrane domain, and a cytoplasmic domain. The KLRB1 protein is classified as a type II membrane protein because it has an external C terminus. [provided by RefSeq, Jul 2008]
A study in humans identified the KLRB1 as one of ten key hub genes with higher expression in healthy controls compared to sepsis patients, classifying it as a potential diagnostic biomarker for sepsis [Li et al. DOI:10.3389/fimmu.2024.1445858]. Another human study, employing machine learning, identified the KLRB1 as one of the top three important genes for an XGBoost model in sepsis diagnosis via SHAP analysis [Shi et al. DOI:10.3389/fimmu.2025.1640425].