| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCCUCACAUCACACAGCUGCAGAGAUGAAUAAACAAAGAGGAACCUUCU… | 1238 nt | 0.3748 |
Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. The group, designated KLRC (NKG2) are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The KLRC (NKG2) gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. KLRC2 alternative splice variants have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the KLRC2 was one of three genes consistently dysregulated in blood at all time points following severe burn injury, indicating its association with injury progression [Wu et al. DOI:10.007/s10753-019-00984-5]. In human research, scRNA-seq analysis of a radiation-exposed patient revealed the KLRC2 was highly expressed in specific NK cell subsets (NK3 and NK6), where it is involved in immune activation [Yan et al. DOI:10.3892/etm.2025.12846].