Basic Information

Symbol
KLRC2
RNA class
mRNA
Alias
Killer Cell Lectin Like Receptor C2 NKG2C NKG2-C Type II Integral Membrane Protein NKG2-C CD159c Killer Cell Lectin-Like Receptor Subfamily C, Member 2 CD159 Antigen-Like Family Member C Natural Killer Cell Receptor G2-C NKG2-C-Activating NK Receptor NK Cell Receptor C CD159c Antigen
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_002260.4
Sequence length
1238.0 nt
GC content
0.3748

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-296.40 kcal/mol
Thermodynamic ensemble
Free energy: -321.71 kcal/mol
Frequency: 0.0000
Diversity: 284.74
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((.((...((.((....)).))..........(((((...))))).)).)))))(((((((.((((((.....((((((...((..(((((...((((........(((......)))........((((...))))..(.(((......))).)...(((..(((((((....)).)))))..)))............)))).)))))..))..........(((...))).)))))).)))))).))...(((((.((((..((((((((((((((((((..........(((((..((((......)))).))))).....(((..((..........))..))))))))).....))))))))).(((((((...((((........))))............((((((((((..........((((((((((..((..((((((((....(((((.....((..((........))..))....))))).((((((...))))))))))))))..))..))))))....(((((.(((........))).))))).((.((((((((((((......((((...((((((....(((((......((((((.(((((((((.((......)).))))((((((((((....((...((((.(((((.(((((.((((((((((((....((((((((((.(((((((((....))))))..))).)))))))))).((((((..(((...((((((((......)))))))).)))...((((((.((.......)).)))))).......)))))).................))))))))....)))).)))))...............(((((..........)))))))))).))))...)).......))))))))))...((((..........))))...))))).))))))..))))).))))))))))......)))..)))))))))))....))))..........))))))))))))))))))))....))).).)))))(((((((.(((((((((.((((..((((......)))))))).)))))....)))))))))))((((...(((............)))....))))..(((((...)))))......((((((...))))))(((((((...(((....))))))))))...))))).........
Thermodynamic Ensemble Prediction
..(((((.((...{{.{(,,..||.|}..........((((,...})))}.}}.)))))((((({(,((((((.....((((((...{(.,(((((...((((........(((......)))........(((,...})))..,.{({......}}).,...(((..(((((({....}),}))))..)))............)))).))))),.)),,........({(...))).)))))).)))))).))..,{{||{|{{{|,,{{{((((((((({(((({......,,,.(((((..((((......)))}.))))).,}},||,..,,,,,,,,....||,.,...}}.,}.,...))))))))),{(((((({.,((((........)))}.|....,|....|{{{{{{{{{..........{{|{((((((..{{..((((((((....,{,,,.,,..,,..,{{{{,...,,..,}},,..,)})).{((({{...})))))))))))))..})..)))))},,..(((((.(((........))).))))).{(.((((((((((((......((((...((((((....(((((......((((((.(((((({{{{(({,....|,,|}|,((((((((((.,,.((...((((.(((((.(((((.((((((((((((....((((((((((.(({((((((....))))))..})).)))))))))).{(((((,.,,....((((((((......)))))))).|||,,.{{{{{{.||,,,....||.||}}}}.|||...,}}))).......,,........))))))))....)))).)))))...,,,....}},..(((((..........)))))))))).))))...))....,..))))))))))...,,||.,,.....)))))}},,))))).))))))..))))).))))))))))......))),.,))))))))}|....||}}....,,,,,,|}}}}}}}}|}}}}})},|}|||,,}}.},}}||}|||||||,(((((((((.((({|,{|,|......},)}}})).)))))....)))))))))))|||{,||||,....}}})},}}}}},,..}}}}.,|{{{|..,})))}.....,||||||,,.}})}}}(((((((...(({....))))))))))...))))).........

Transcripts

ID Sequence Length GC content
CCCUCACAUCACACAGCUGCAGAGAUGAAUAAACAAAGAGGAACCUUCU… 1238 nt 0.3748
Summary

Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. The group, designated KLRC (NKG2) are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The KLRC (NKG2) gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. KLRC2 alternative splice variants have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the KLRC2 was one of three genes consistently dysregulated in blood at all time points following severe burn injury, indicating its association with injury progression [Wu et al. DOI:10.007/s10753-019-00984-5]. In human research, scRNA-seq analysis of a radiation-exposed patient revealed the KLRC2 was highly expressed in specific NK cell subsets (NK3 and NK6), where it is involved in immune activation [Yan et al. DOI:10.3892/etm.2025.12846].