| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGUUAUCAUAGAGCACAGUCCCUCACAUCACACAGCUGCAGAGAUGA… | 1025 nt | 0.4020 | |
| GCAGUUAUCAUAGAGCACAGUCCCUCACAUCACACAGCUGCAGAGAUGA… | 843 nt | 0.3998 |
Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. KLRC3 is a member of the NKG2 group which are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The NKG2 gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
A study in humans using single-cell RNA sequencing of peripheral blood mononuclear cells (PBMCs) from an irradiated patient and healthy controls identified KLRC3 as a gene marker highly expressed in specific natural killer (NK) cell subsets (NK3 and NK6), where it is involved in immune activation [Yan et al. DOI:10.3892/etm.2025.12846].