Basic Information

Symbol
KMT2B
RNA class
mRNA
Alias
Lysine Methyltransferase 2B MLL2 TRX2 HRX2 WBP7 MLL4 Histone-Lysine N-Methyltransferase 2B KIAA0304 CXXC10 MLL1B Myeloid/Lymphoid Or Mixed-Lineage Leukemia (Trithorax Homolog, Drosophila) 4 Myeloid/Lymphoid Or Mixed-Lineage Leukemia Protein 4 Lysine (K)-Specific Methyltransferase 2B WBP-7 Histone-Lysine N-Methyltransferase MLL4 Mixed Lineage Leukemia Gene Homolog 2 Lysine N-Methyltransferase 2B WW Domain Binding Protein 7 WW Domain-Binding Protein 7 Trithorax Homologue 2 Trithorax Homolog 2 EC 2.1.1.364 DYT28 MRD68
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_014727.3
Sequence length
8485.0 nt
GC content
0.6348

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3714.94 kcal/mol
Thermodynamic ensemble
Free energy: -3850.06 kcal/mol
Frequency: 0.0000
Diversity: 2703.84
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((..(((((...(((((((((((.((((((((((((.(((.((((((.((........)).)))))).))).))..((((.((.((..((((((((((((((.(((((..((((.((.(((((((...((((((...((.((((((((((....((((.(.((..((((.(....).)))).)).).)))).(((((((((((...((((((((((((((((.(...((((((((..((((((((((((((.((((.....))))))))))..)))))))).))))))))).)))))))).))))))))((((((((((..(((((.((((.....)))(((((.((.((((.(((..(((((......((((((((((....((((...((..((..(((....(((((((((.(.(((...((((((.((.((((.......).))))).))))))...))).).)))))))))..)))..)).))...))))..)))))))))).......((((((((...............(((((((((((((....((((((((((.(((.......(((.(((.((((..((((........((((((.((((...((...))...)).))))))))..((((..(((.((.(((((...((((((((((.(((((....(((((...(((((..(((((((...(((((.((..((((..((((((((((((.((((......)))).))....((((..((((.(((.((.(((((((((.(((((((....((......))...))))))).))).))))))))...))).))))...)))).((((((....(((((..(((.((.(((.(((((((..(((.((((((((((((((..((((((((((((((..((((((((((..(((((((((((((((........................)))))))))))..))))..))))).((.((..((((((.........))))))....)).))..)))))..)))((((...(((....((((((....((((((......))))))..((((.(.(((.....(((((.((.(.((((.......................((((((.(..(((.(((..(((.(.((((((((((.(.(.....).))))))))(((..((..((((((...............))))))..))..)))))).).))).))).)))..)))))))......))))..).))))))).....))))))))))))))....)))...))))....)))))))))))..)).............((((((((((....)).))))))))...((((((.(((((.(((.(.......).))).))))).)))))).((((((((........((((.(((.(((.((((.(((..((.((..(((.(((...(((((...)))))))))))............(((((.((((((((.(((((((.((...((((...(((((.(((((((...(((..(((.((((((((..(((...((((........)))).((((.(....)))))((((((.(((((.....))))).(((((((..(.(((................(((......)))(((((((.((.......)).)))))))...................((((((.((((....(.(((.(((.(.((((......(((....((((..............)))).))).....)))).).)))))))..))))..))))))))).)..))))))).((.(((.(((.((((((((((....(((....((((((..............(((((...........((((((((((((((((((((((((.(((((......(((((((...((..((((.....))))..))....)))))))........((((((........(((...(((..((((((.....)))))).)))...))).........))))))........(((((((((((.(((...))).((((.(((.......((((((.((((((........))....((((...))))........)))).))))))..(((....)))((((.......))))..))).)))).....))))))))))).((((((...))))))((...))...(((((((((((((((.(((......)))..((((((.((.(((((((((.((((.((..(((((...((.((((((...)))....(((((.....)))))(((.(((.(((((((((.((((((((.((((((............))))))......((.....(((.(((..((......))..))).)))...))....(((((((.......)))))))..)))))))).))).((((((((.(((((((((((.(((....((((((...(((((.....))))).)))))).((((((..(((((((........((..((((.(((((((..........))))....)))...)))).)).......))))))))))).))((((((((((.((((...))))))))))))))(((...((..((((((((((((...(((.((((.(.(((((((((((.(((((((........((((.(.......).))))........))).)))).))..))))))))).)))))..))).)))))..((((.(((((((...........))).)))).))))))))))).)))))....))))))))))...))))..))).)))))..))))))..))).)))..)))))..)))))..)).).)))))))))((..((((((((((((...))))))))(((.........)))..((((........))))....))))..)).))).))))))))....((((..(((.(........(((((((((..............((((......))))((.((((((((....)))))))).)).(((((((....))))))))))).))))).(((((....))))).)))).)))))))))))))))))))))))))))))))))))))))(((((.....)))))..)))))))))..........(((((((.((....))..)))))))((((.....(((...((((.(((.....))))))).)))..))))((((.(((..((((((..((((((((((((.(((((.....)))......((.((.......))))..))))))))))))).)..))))))...........(((((((....))))))).....))))))).)).)))(((..(((((.((...((((...)))).....)).)))))..)))..))))))...)))..))))....))))))..(((....)))..))).))).)).......)))))).)))..))))).))).)))..)))....))))))))).))).........)))).)).))))))).)))).)))))))))(((((.....)))))..(((((..((((((....)))).))..))))))).))..))).)))).)))...))).)))).)))))))).))))))))))))))))).......(((((((((((((.......))).......((((((((.((....)).))).)))))......((.((((((((((.....((((((((.(((.((((((...(((....(((((((((((.............)))))..((.(..((((((((((.((..........)).))).)))))))..).))..(((((((.((((((((....(((.(.....).))).))))))))...........)))))))(((((((((((...........((....))......((..((((.(.((((((................................)))))).).))))..))....))))))))..))).(((.(((((((.((((.............)))).)))))).).))).))))))..((((.....))))..)))...))))))))))))))))).(((((((((((.....)))...)))))))).))))))))))))..))))))))))))))).))).)))))..)))))...))).)))..))))))))))))))..))..(.((((.(((.((.....)).)))..)))).)..))))))))))))..)))))((((...(((...(((((((.((((((....((((((........)))))).....)))))).)))))))..)))..))))...)).))).....))))))))))))))).)))))(((((((...((((..((.((((((..(((........))))))))).)).(((.......)))))))..)).)))))((((((((((((((.........((((((......((((((((((((.(.((((((.(((((...))))).).)..)))).).)))))((((((((.((...((.......((((((((((((((((((...(((((((((....(.(((.......((..(((.((.....(((.(((((((((((((((((.(((((((((((....(((((((..((.(.((((........))))).)))))))))....)))))))...(((.(((....))).))))))))).)))).))).))..)))))).))).....)).)))..)).......))).))))))))))(((((((.((.(((((((.((.......)))))))))((((.((((.((...((.((((........)))).)).)).))))...))))(((.....)))..)))))))))((....)).(((..(((((.(((......))))))))..)))........))))))))))).)))...........((((.(((.(((..(((((((((((....((((((....)))))).)))))))))))..)))..)))..))))....((((.......)))).)))).......)).)).))))))))..)))))))))))))))))))))))))))...(((((((.....))))))).((((((((((((((((((.(((((((........)))))))))).)))))(((((((((((((((((.......)))))))....))).)))))))((((.....))))..)))))))))).(((((...((((.((.(((.(((.(...(((.(((((((..(((..........((((((..(((....)))..)))))).......)))..)))).))).)))).)))))).))))))))))))))))..))))..))))..)))).))).)))...((.(((.......))).)))))..)))))..)))))(((........)))((((.(........).)))).(((((((.((.....)).((((((.(((((((((...(((((((((((((.......((((((((((.(((((((((................)))).)))))...)))))).)))).......)))......(((((((((..(((....((((((.((((((((........))).)))))......((((............(((((..((((....)))).....(((((((.(.(((.(((((.((....((((.((((((....))))))(((((((((.....(((.((........)).))).))))).)))).....))))...)))))).).))).).)))))))....)))))((((((....(.(((((((((....))).))).)))).)))))).))))...(((((.(((((((((((((((.((......(((((...((((....(((((.....)))))....)))).)))))(((((((..(((......)))..)))))))...)))))))...))).))))))))))))....)))))).((.((........)).))..)))..)))))))))..........(((((((..((...))..))))))))))))))))).)))))))))..))))))..))))))))))))))))))))...((((((.((((((.(((((((.(((.((((.(((((((.(((.((.(((........))).)).)).........).))))))).)))).(((((((((((.......(.((((...)))).)))))))))))).((((....((((.(.(((.(((....))).))).).))))..)))).......((((((((....)))((((...))))((((((...)))))))))))....)))..)))))))))))))))))))........)))))))).......(((((((((..((...)).))))))))).......(((((.(((((((((((...((((..(((.....)))..)))).))))))....)))))))))))))))))).)))))).)))))).))))).)))))..)))))))))))))).)))))))))))).))....))))))....))))))))).))))..))))).))))...))))))))))..)).)).)))).))).))))))))))))..)))))).)))))..)))))(.((((((((.(((((((((.....((....................))...))))))))).)))).)))).).((((..((((.....))))))))((((((..((((((((((.((((((..((......))....))))))))))(((((((((((((...)))).((((((.(((((((.((((....((((......)))))))).)).)))))..))))))........((.(((((((((.(((((.((((.(((.((((((...((((.....)))).(((((((((((...((((....))))))))))))..)))((((((((((((((.....))))((((....)))).......(((((.((((((.....))...))))..(((((.((((.(.......).)))).)))))))))).((......))..)))))))))))))))).)))....(((((..(......)..).))))((((((((((..((((.(((((..(((..........)))...))))).))))..(((.....((((((......))))))))).(((((((((((......(((((((((((..((.(((...))).))....))))))............)))))..))))))))))))))(((((((......)).)))))..))))))).)))).))))))))))))))))((((((((((...((.((.((((((.(((((((....(((....))).((((((((...(((.((((.((..((((..((((((..((((..((((.((.(.((((((....((((((......))).)))...((((((((..........))))))))....(((.(((.((((....((((((.(((((.(((....).)))).))).)))))).((((......).)))(((.((((((((((((((((....((((...))))...)))))))).((((.(.((.(((((((........((((((..((.((....(((((((((.(((..((((((((((((((((((.(((((.((.((...(((...))).)).)).))))).)))))).(((....)))(((......))).......))))))))).(((.(((((.(((((((...)))).)))..))))).))).(((((((..((((...((((((..............))))))))))..)))))))((((.....))))...)))))))))))))))..)).)).))))))..........(((((.(((((.......)))))...)))))...)))))))))).))))..)))))))).))).......(((((((....))))))))))).))).)))(((..(((((((.......)))))))..)))))))))).))))))..))))..))))))....))))...))))))))).....))))))))......))))))).)))))).)).))...))).)))))))..................))))))))).(((((((...(.((.((((((((....))).))))))))..)))))))..))))))..))))))
Thermodynamic Ensemble Prediction
..,,,..((.({{((((((((((((((((((((((((....))))))).((((((((.(((((.((,((((.{{.{{{.,((((({,((..,)})))}||,{}||.||,}|}},}||}}|}.((((,({{(((((((({.(((((,((({.((.((,(((.{,((,((((((({(.(((({{{.(({(((({{,,(({{(((((((....{{{|||{|||||{{,,|}..||||||||,.||{||||||{((((.((((.,,,,))))))}})),,))))))}}.))))))))|{||}}||||.}||||}}((((((((((,..({{{,,.((|,..,.}}}((((((((.(.(((((..(,(((.....,.((((((((((....,(((((,((,,,,..|||,,..(((((((((.(.(((...((((((.((.((((.......).))))).))))))...))).).)))))))))..}}}..}}.})}}}},,,..)))))))))).(((((((((((((.,,,,..,........((((.,,....((((..((((((((((.((((((((..(((((((((.(((.(((...((((..,(((((.((((...((...,)}..)).)))))))|{.(((((.(((((.((((((((....(({{(({{.((((..,,,|}}|.}}}}|))).((((....)))).(((((,,((.{...,,,,,.(((((((,.,..((,(((.((((..((((((..((((.(((.((.(((((((({.(((((((....((......))...))))))).})),})))))))...))).)))).((((((...))))))..))).)))..)))),}}.,,(((((((({((.((.(((((,.,.((..(((((((((((,,,.((((((,(({(..,,,||||{||||||{...............{{{{{..,{|}||||||}||,.,,,,..)})))}}}.|},.((((((.{.......))))))..,.}}|}}},|||.,..|,,}|||...{{{,,..((((((....((((((......))))))..((({,(.(((..,..(((({,((.,.((((.......................((((((.(..(((.(((..(((.(.((((((((((.(.(.....).))))))))(((..((..((((((...............))))))..))..)))))).).))).))).)))..)))))))......))))..,.))))))).....))))))))))))))....}}}...}},),}.,)))))))))))..))..))))))).)},((((((((((....)).))))))))...((((((.(((((.(({.........}.))).))))).)))))).})))))))((((.((((..(((....)))))))))))..|||||,.(((..(((...((((,...,,.)))))....,)}..}}).,}}}.})))}}}(((.((((...{((..{.....,}..))).)))))))....{((((((({{,.....},......((((........)))).}})))).})))..)))))))).(((((.....))))).,,({.,.....|||..,.....,,},},,.},},}....)))))))).))))).))))).)},.........................))))..))),.))).)))))},)))..))).......))))).....))))).....))))).,)))).{((.,,.,,..}}}..}}))........)))}..)))))))).)))))........,.))),}..))))),,))))))))}}))))))).,..}}}})))}))))}},})))).,,)))}},}}|}))}}||,||.}}})|)))}}},}}))).})}|||}}}}...|||..}}}}..,|{{{({{{(((((({(((((((((.(((((({....{{(((.......,,((((.((((...((((((((((.{{{...,(,((((((...(((((((((((((((((((.((,{{{|||{((((,,,{.......,,,|||.|,}}}}}.}}}...|},.({((((,{.||.,.{{({,..}|||.||||}|.{{{|.,..)))}|,|}.|},},}})}..,))}))))}}...))))))))))).((((((...)))))){{...}}.......((.((((((((((((..,,,((((.,{.(((((.,.(((((((,,...((((((.((((.((....||(((.{{{({{,...(((((.....))))){.((((.(((((..((((...((((((((((((..{,.,.......,}.,,..{.(((((((((.((.(((..((......))..))).|||,,.||....(((((({.......)))})))|,||...(((((((((.,((((((((.(((,{{,((((({..,,,{((({{{(.(((,((....((((((((((({..(({((.((((,..(((.......)))((((....))}),.{.((((((((.(({,{(({{,{(((((...{{{(({{(({(((,{{,,((((((((((.((((...))))))))))}||}((((({.(.,{....,}|||}))).|||,((((,(.(((((((((((.(((((((........((((.(.,..,,||.}})).....,}.))).)))).)},.))))))))).))))}..|||(({(((((..(((.((((((......(((((((....)))))))}.(((.|....,))).....)))))).)))..)))))})})})))}))))).,,.}}})}))))),,,.)))))))}}.,))},((((((((((..,(.{{..((.((.(((.{((((((((.((((((((((((.,.(((.(..(((((((...((((((.....{,((((((((({......((((((((((..{(((.((((((((.....{{.....((((((......)))))).((((((((....)))))))){({.(((((((....)))))})}.},))((((((..((((((((((..((.((((....)))))).,))))))))))..)))))).(((((....)))))..(((((((((,,({((({.....))))||((({{.,{...,)}.,||||||},,,...,,}||,}|.((((.{((.....))))))).}}}...,,))))).)))),((((((..{(((((((((((.{((((.....)))}.....,{.{(.......))))...}))))))))))).)..)))))).,...,}....))).))))).))))((((((..(((((,{.(((.,(((((....((.(((((...(({(((((((....,.((((((((.((((((((((,((((...(((({,{{(({(,.,.{({,((((({{...,,)}))).)),.,..))})},||..((((({.((((((..{((((..,(((((((((..,,(.((.|,....|),)))}..)))))))))|.(((.((.(((((((.....)))))}}).)).))),.))))}.)))))).).))))).((((((({(((..((((((((((((((((((({.((((....)))),}{(((((({({{(({({,.,,|,|||{{((.{.{(,.(({.....}}},,|}.}.)))).}})..,})}))))}..,,,.{{||,.{{(((.((({(.({({.,,|}||,,|||}.||,...))..})}.)))||{{{.},...,,...,,)))}}..((.{..((((((((((.((..........)).))).)))))))..,.)),}))))))}.)))))))),,))).)))).......})))..))).).))))))).))))).)))),}....)))))))).)).))))))))..{((((..((..(((({({{,,((((.,..,,.......,,.,...)))}.,.)}.))))),,})..))))},,..(((((((((((,(({.(((.(((((((.((((.........,,..)))).)))))).).))).{{{{((.((((.(((((....))))))))).)).))))||||((((((((((.((((.,((.((((((....)))))))))))).))))},))))),,{{|||,,}}|{||{||{{,,{({....|||||}}}}}))}})},.)),,))))))))))).)))))))..)))))))).))....))))).,))).})))))...))))))..)))},))))))(((((((.((((((...{(((,{,,.......,,)),,}}}}.)))))).)))))))))))))))))|....,.(((((.(((.((({.{.((((((,{((({{((,{,,..,{}|{||}|.{{{{{||||{|,...,,,,)),)))))){(.((((.((((.({........))...)))).)))).)}}))))).}.,...})).))).)))))..,,})))))))))))))..}.)))..,.)))))).).)))))...)))),))))}.))).)).)).}}.,....)))))))))))))))))}..(((((.(((..((((((((((((({{{((.{{..(((((((((((((.((..((((((...((.(({...}))..))...)))))).....,.(((..((((({{((((({(,.{,{({{{{,{(({({{,.,,{((((.({{{.,,,..,)})|||},}||||||{{({,,{(({(.((((,(,.,,..,||)}}}}}}})}..,,{{{.,{((((((((({(,(((.(((((((.((.......))))))))}....))))).)))))))))},,}}),)))}}}}}}}|||||{|.|{{.|||||{|.....},||||{{|||,..{(..,,)),.,,(((((({.((,,((...|{|((({,..}}}}.,.,.}},,}}}}))))}.{{{.,{{|,,,,,,{((((.....))))|{{{{{||||,.|}}(((((,,,,,|||}}},||}||||||,,.{{{{{||,},,|||,,,)}|{{{}}},|||,,,)|}|}}{||...|,|,,}.,})))}}..})))))}.)))))))))))))),},||||||{{{{|||,,,..)}))))}.((((((((((((((((((.(((((((........)))))))))).)))))(((((((((((((((((.......)))))))....))),}))))))((((.....))))},))))))))))..,||,,|||}}}}.}})})}}}}}..,,,},,,..})}))),})},))))),,,))))..)))}),))))))},)))))).....,,)})}}...,,..,)))))).)))))))))).)))))))))))))),.,.)))))}.}),)))),,})}.}}||}|,,}}}}}..)))})))))))))))))|((((((((........)))))))}........{((,....,}),,}.((({....(((((((((...,))),})))}}..))))...))))))))).,,((((((((.(((((((((................))))))))))...)))))))),})},,......((((....}}}),,,...)).))))))))).,((((((((........)))))})))...)))))))}.....,.))}}.)))).))))).)))),,......,{{((((((((((((.((((..{{{...,((((((((....))}}}}}|||,,,(((.(((((((((....,,{,(((((..(((....))).))))).))...))))))))).)))}))..)))).)))).)))}{{{|.,,..,.||||||(({,,.,))).))),)}}.}))))))..)))...|,,{{{(,,((((((,.(((({((.({...((((((({(((((...({{{{,,{{.||,||...,}|}}.,},}.(((((((..(((......)))..)))))))...|}}}}})}..,))))))),))))).)))),,).)))))|,{{........)),)),))))))))..)))))).))).))))|.))))).))})))).....)))).))))}})))))..(((((....)))))..)))).)))).,))))))))..}}}.,)))).)))))).)))))))),|...,..))))}...},|))))}...}))))))))},,.{{{....}}),..,((((,(((((({{.(((((((((((.....{.(,({{{...)))),,))))))))))).((((....(((((({{(((.(({{{.{((({.{{...||{{..{{|..((((((({.,(({,...}}}..((({{.,{(((((....(((({(.((((.....)))).))))))))))))))))),,..{{{{{{(((((.,((({....,,,((((,,..|}}}..|{||||||},,,,|{|..,.{|({(((((.{((,(,..,,,|}}|,,}}}}})),..}))).}}},))))))))..{{{{{{{{..{{{{((|...{{{,|||.{{{....{{|.,..))),...)))..)).)))..)}))))))..}})))))).,{{{{{{,,,,{{,,,,}},.|,({(({...((((((,((({((,.((.((((((......))))))...))},))})))).)))))).))))){,((((((((,(((((((((.....{{....................)}...))))))))).)))).)))).}{((((..((((.....))))})))},||})))||)),,)|)))))||||.{(..((((.((........)),)))}|,))}}||||}}.}}).,)}||.}}|}|||,|||}}...}}}|((((......((((((|....,)))))}.,..))))}...))}}}}|,{,}}||,.,.,,,.,|}))))))),)}))...((((.....)))){((((((,(......))))))}.,....}))))))).))))))|,(((((.....}))))|||((((....)))).....,,}..}}}))))),..{(((..((((|((.(((((.((((.(.......).)))).))))))),))))))))..||{{{.|{|.,|||{||||,|{{||....(((((..(......)..),})))((({{,({{{.(((((.(((((..{{,..........}}),..))))).))))}.}.},}.||{(({,(,,,..,|,|||{{.{{((((((((((,,.{{.{(((,,,,||||..,|},|,}}})),.,,...,|||||,,{{{{{{..{{,|||,|.,|||||||{||{((.(((((((......)).))))).)))),|||{||||{||,||,,.,)}}}}).}}}}|||.|....,,.,|}}))}}}}}{((({.({,,((({((((((...)))))},}))))}}.}}.)),.,{(({{({((,(({(((({{((,..,{.,.,.||,,....})))|}})))}}}},,|||...((((((((..........)))))))),,..{{{,||||{{{({((.((((((.(((((.(({...,}.}}))}})).)))))).}}|({{((((({.(((({.((,(,,((((..({....,,}}))..).)).})))))))))))}).|,|,|,{(((((({,,{{,{,.{(({(|,.,{,{|||||(((({|,,,.,|{{{((.{{{({{{{,{{{{{{.{{{{{.||,|.,,.|({.,,||,.})})),))))).))))),.(((....))){||,,..,.))),},...})})))))),.|||,(((((.(((((({...}))).)))..))))).))),{|{||||,}||||||,||||||.......,......})))}},}},.))))))),||||}.,..||||,...)),.}}}}|||||,..))})){||,|||({,....,}}}}|||}|||||.,}}}}.))))).}})))).,,.)))))))))))))))))))))))))))})}..,,,,(((((((....))))))}.||}|,||{{{{(((..(((((((.......)))))))..))))),)))).|||{||..(({{,,{|||||....,,,...||,}}|,,.},....((((((..........))))))...|||{,{(((.{{{,..,,,,}}}.}}}}.}}})...........,,,,,,..,,,,.....)}||}|||||||{..,,|||..,}}})))}}.........))))},.,))))).

Transcripts

ID Sequence Length GC content
CUCUCACGGUGCCAAGAUGGCGGCGGCGGCGGGCGGCGGCAGUUGCCCC… 8485 nt 0.6348
Summary

This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans using monozygotic twin pairs discordant for BMI demonstrated that the KMT2B was upregulated in subcutaneous adipose tissue in females with obesity but downregulated in males with obesity, indicating a sex-specific transcriptional response to acquired obesity [Haltia et al. DOI:10.1002/oby.70078].