| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCGCUCCGCUCCAACACAAAAUAGGGCCGCCUCUUCUCCUUUCUCCCC… | 20635 nt | 0.5978 |
The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010] CIViC Summary for KMT2D Gene
A study in humans demonstrated that the KMT2D gene, a lysine methyltransferase involved in chromatin remodeling, was differentially expressed in subcutaneous adipose tissue in a sex-specific manner during obesity, being upregulated in females with greater BMI but downregulated in males [Haltia et al. DOI:10.1002/oby.70078]. Separately, a forensic study in humans developed an RNA typing system for individual identification from hair shafts, where the KMT2D gene harbored coding SNPs (rs11168830 and rs2241726) that were part of an 11-gene multiplex assay with a combined discrimination power of 0.999969, showing 100% concordance with DNA typing and species specificity [Liu et al. DOI:10.1016/j.fsigen.2023.102929].