Basic Information

Symbol
KMT2D
RNA class
mRNA
Alias
Lysine Methyltransferase 2D MLL4 ALR Histone-Lysine N-Methyltransferase 2D CAGL114 MLL2 Myeloid/Lymphoid Or Mixed-Lineage Leukemia 2 Lysine (K)-Specific Methyltransferase 2D Trinucleotide Repeat Containing 21 Lysine N-Methyltransferase 2D ALL1-Related Protein TNRC21 Myeloid/Lymphoid Or Mixed-Lineage Leukemia Protein 2 Histone-Lysine N-Methyltransferase MLL2 Kabuki Make-Up Syndrome ALL1-Related EC 2.1.1.364 KABUK1 AAD10 BCAHH KMS
Location (GRCh38)
Forensic tag(s)
Individual identification Other applications

MANE select

Transcript ID
NM_003482.4
Sequence length
20635.0 nt
GC content
0.5978

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-8507.80 kcal/mol
Thermodynamic ensemble
Free energy: 100000.00 kcal/mol
Frequency: inf
Diversity: 0.00
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((.....(((((.((.....((((.((((......(((((((((((.......((((((((((..((((.....))))...((.(((((((((((..((((((.(((.(((...(((.(((((((((.....)))))..((......))(((....)))...((((((..((((.....((((((.((((((((.(.(((((.((((.(((.(.((((.((...(((((((((((((((....(((..((((((((((..((((((.(((....((((((((....)))..)))))(((((((((((.....((((((((.((((.((.(((((....))).)).)).))))..))))))))..))))))....)))))..((((((((((......))))))..)))).))).))))))..)).))))).))))))....))))))))))))))).)))))).)))))))).)))))).)))))))).))))))..(((((((.((.(((((((......)))))))))...))))))).((((...)))))))))))))))))).))))))))).))))))))))))))))).)).....)))...))))))).(((((((((((((((.(((((((.....)).)))))..)))).))))).)))))))))))))))))...)))).))))((((((((((((.((((((((((((.(((.(.((((((((((....(((((..(((((((..((((..((.((.((((.((((........)))).)))).)).)).)))))))))))((((((((((((((((.(.....).)))))..........)))))))).)))..((((((((((((((((...((...........))...))).)))))....))))))))..))))).)))))))))).).))).)).))))............)))))).))))(((.((((.((......)).)))))))...........((((((((((.(((((....(((..((.....)))))..))))).))))....))))))((((((((((.((..(((...(((((..((((.(((((.(((((.(((((((((((((.........((((((..(((.((((((...((((...))))))))))))).))))))))))))...(((((.(((((((((((((..(((((((...))))))).((((((((..(((((((....((((..((..((.(((.(((...)))))).))))..)))).)))))))((((((.((((.........))))..)))))).)))))))).....(((((...(((.....(((((((((((((((.(.((((((((((.(.((((((((..((.(((((((((....))))))))).)))))..((((((((.((((.((((.((((((...)).)))).......)))))))).))))).))).((..(((((((.....)))))))..)).....(((((((.(((((((.(((((((.(((......(((((.((((.((((.........))))...)))).)))))))).))))))))))))))..(((...)))))))))).((((.(((((((((.(((((((.(..((((((((......((((((.(((((.((....(((((((((.......((((((..((((...((....(((...((.(((((((.(...((..(((((...((((((((((((((((.((....(((((((((.(((((((((((...(((((..((((.((......((((((((((.(((.....))).))).....)))))))..))))))))))).)))))).))))))))).)))))...))))))))))).)))..))))(((((((...(((...((((.((((.((((((((((((((.(((......)))....(((.(((....))).))).))))).))))))..)).).)))))))).))).)))))))..((((((...(((........)))(((((((((((.(((((...........))))))))).))...)))))...((((((((...(((.(((((((((((((..((.(..(((((((.((((((((((((((((.((((.(((((((((((...............((((((((....((..((((.(((((((.....(((.......))).))))))))).)).))..))))))))))))))))).((((((....)))))).........)).))))))).))))))).))))))........((((.....))))........)))))))..).))..)).))))))))))).))).))))))))...))).))).....((((((((((..(.(..((........))..).)..))))))))))....)))))..))).))))))))).)))...)).))))..))....))))......)))))))))....)).))))).))))))))).)).....))).))))))))((......))....)))))))))))))...(((.(((((.((..........)).))))).)))....))))).).)))..)))))((((((........)).)))))).))))))))))))))))))).)))))..........)))).))))..)))))))))).)).)))))))))))))))))))..))))))))..)).))))))))))..((((.((((...(((((((((((..((((.(((((((((.(((((.((((((((((((.(((((((((((.(((.(((((((((((((..................((((.((((....((((((((.....((((.(.((....)).).)))).....((.(((......((((((((......))))))))))).)).((((((((((......(((.((((((..............)))))).))).((((..((((((.(((.((((.....))))((((.((.....)).))))..((((((...((((((.((((((((.((((((((((.(((((((((..((((...(((((................)))))...))))..((((.(((((((((((..(((((..((.......))..).))))..)))(((.....((((.((((((((.....)))))(((.((.....)).)))..((((((((((.(((((.(((.(((.....)))(((((....(((.(((.((((........))))...))).))).((.((((((((((((..(((((..((.((.((.((.((((....((((((....(((((((....(((...((((((((..(((((.(((.......((.(((((((.((((..........)))).))))))).)).(((((((((.(.((((((.((((...((((((....))).))).(((((((.(((.....))).))....(((((((((((..((....))..))))))))))).(((...(((....(((...(((((((.((.(..(((..(((.((((((....((.((((...)))).))......))...))))...)))..)))..)))))))))).)))....)))...))).((((((((.(((....((.(((..............))).))....))).((((((((((((((...(((((((.(((.((..(((....)))..)).))).))).(((((..((((((((((((((((((..............(((((.(((((((.((......)).)))))))..)))))....((((((((((((..(((...((((((((((...(((((....)))))......((.((.((.((....)).)).)).)).....((((((((((((((.......((((((((((((((((((.....)))).(((((((..((((((((((((.((.((((((((....)))))))))).(((((.....)))))..)))))).))))))....))))))).....(((..(((....((((((....((.(((....(((.(((((((((..(((((.((((....((((.....(((((((((.((((((((((.(((.((.(((....)))(((((((((((((((((....(((..(((....((((((...(((((.......(((..((((.(((..((((((.(((((((.(((.((((((.((.((((((....(......)....)))))))))))))))))...)))..))))..)))).))..).)).))))...))).........))))).))))))(((((.(((.(....((((.((.(((((.(((....(((((....))))).............((((((((((((((((..((.(((..((..(((...(((((((((((.....(((.(((.......))).)))..(((..((((((((((((((((((.((.......)).)))..))))))).))))))))...)))))))))).((((((.(....).)))))).))))...((((((((...)).)))).))...)))..))..)))...)).))))))))))..(((((.((....((((..((((((((((....(((((........)))))))).............((..(((....)))..)).....((((((((((((.(((((....))..))).)))))))))))).(((((((.(((((....)).)))))))))).))))))))))))))))))....))))))......((((....))))(((((.......)))))......(((..((........))..))))))))))).))...))))....).))).)))))....(((...)))))))))...)))))))))))..)))))).((((.((.(((....)))..))..))))........(((..((.......))..))).)).))).))))))))))))).)))))).)))))))))))))..).)))))))).)))....)))))...))))))......)))...)))))))))).)))...)))).........)))..))))))))))).((((((.((....((((((........))))))))))))))....((((.(((....((((((.....))))))))).)))).....))))))))))))).)))))))))))).....(((.((((((.(..(.(((((((((((((((.((((.(((.((((....)))).)))(((((....)))))(((((((((((((.((((((((((((((((((((..((((((((.((..(((...)))....)).))))))))..((.(.((......))).)))))))..))).))))))).))((((((((..(((((((((((...((((....))))((((((.((.((..(((((((((((.((((..((((((.((((((.........)))))))))))).....)))).......)))))))))))..)).))...))))))......(((((....((((.(((..(((((..((.(((((((..((((.......((((..((((((....))))))..)))).......)).))..))))))))).)))))..)))))))))))).((((......))))....((((.((((((((((((.((.((((((...((...(((((((((((((..((((((..(((.......(((.((..((((((((((((((.((.((((((((...)))))))))).))))((((((..((((..((((.((((((.(((...((((...))))....))).).))))).))))..((((((((((((..((((((...((.((((.(((.(((((((((..(((((..((((..(((...))).))))........(((.(((((.((.(((...(((((.((((....((.(((..(((((((((((((.((.((...((((((.....((((.(((((((((((....))))).)).))))(((...(((((((...(((...((.....(((....)))..........(((((((((..(((((((((.(.(((((...(.((.....)).)...))))).)....(((((((...((.((((.(((((.((((..(((((.(((.((((((((((((((((...((((.(......).)))).(((((((((((.(..((((...(((..((((((((....((((..(((...(.(((..((((((((((((.((.(((((.....)).))).(((((......)))))..))))))))((((..((((((.(((((((...(((....)))(((((((((.(((((((((((((..(((..((((((.((.((....))...))))))))....))).))))))..............))))).)).))))))))).......)))))))........((.(((((.(((((.(((.((.(((((.............((((..(((((...(((((((....(((........(((((((((.((((((((.((.(((((.(((.......))).))))).)))))........((((..(((((((........(((((.((((..((((.((((.(((...))).))))...))))(((((.(........).)))))..))))))))))))))))..))))((((...))))........(((((((((((((((..........((((((.(((..((((((....(((......))))))))).))).))).)))..))))))))).(((((((((((((((...))))))...)))))))))........((((...))))((((((((.(((...)))..))))))))))))))....(((((((.((((((..............)).)))))))))))..(((((((.((......)).))))))).....((((.(.(..(((((.((((..(((((.((.(((.....(((.(((((.(((((..(((.......................((..(((((.......)))))..))...................((((((((((.....)))))).))))......((((....(((.....)))............)))).(((....(((((.....)))))...))).)))..))))))))............((....))((((......)))))).)))..))).).).))))).....)))).)))))..)).))))))))).)))))))))))))))))))....((((((...............)))))).........(((((((((.(((((........)))))((((.....))))))))))))))))))..)))))))))))...)))))).))..))))).)).))))))...)))).))))))))))...)))))))(((((...((........))..))))).))))))))..)))...)))).))))))))...))))...............((((((....(((((((.........)))))))..))))))....))))))))))...)))))).)))((((((((..............)).))))))..))))).....)))))))))...))))................(((..((((....((((.......((((.(((((((((((((.(((((((((((((((...))))))(((((((.(((((..(...(((((((.((((....((....))))))))))))).....)..)))))..))))).))....((((....))))...........((((((((..((((((..((((..((((((((....)))).))))))))...........))).)))..)))))))))))).)))))..)))).))))))))).)))))))).....)))).)))))...))))))).)))))))))...)).)))))))...)).))))))))))...)))..)))).....))))))))))))))).))))).)))..))).))))))...)))))..)))..))))))).)))..........(((((......)))))........)))))..))))))))).))).))))))))).))).))).)))))).))).((((..((((...)).))..)))).....))))..))))))..)))..)))))))..)).)))...(((((((.....((((((((((.((.......(((((((......(((((..........)))))......(((......))).............(((((((((((((((((.((((...))))(((((.....))))).))))))..)))))))))))((((......))))((((((((((((((.(((((......)).)))...))))))..))))))))..........((((..(((.((.(((((((((((....(((((((.((.....(((((((.(............((((((((((((((.((..........))))))))...))..))))))............))))))))......((....((((((((.((((......))))..((......)).....((((...))))...(((((..((.((........)).))..)))))))))))))..)))))))))))(((((.((((...)))).))))).........((((((((...(((........))).)))))))).........))))))))))).)).)))..))))(((.((((..........)))))))....)))))))....)))))))))))).)))))))..((((((....((((.((.((..(((.(....))))..))...)).))))....)))))))))..))))))..)))))))..)))))))).)))))))).)))((((..((.......))..))))(((......)))))))))))).....))))((((((...)))))))))))))))))..))))))))((((((.(....).)))))).)))..))))))))))))).(((((((((........)))(((((((((...(((((.....((((((((.((((...))))))))...))))..((((((((...))))))))..))))))))).)))))....))))))((((((.((......((((((.(((..(((.....))).)))..((((((((..(((((((((((((....))))))))))))).....((((......))))...(((((.....((.((.((((......)))).)).)).......(((((..(((..........)))...)))))((.(((((((((..(((.((...((((((.......(((((...)))))(((((((((((((((((((.(((...)))..((.((((((((((.((((....)))).)))))))....(((..(.((((((((((...)))))).))))....)..)))....(((((((..((.((((((((((((((((((((((((.....)))..(((((((.((((((((.......)))))))).((((.....(((((((..((((.....(((((.(((.(((.((.((.......))...)).))).))))))))...(((((((((..((((........)))).................(((((...))))).......(((((((.(((((....)))))....(((((((.....)))))))..............(((((((((...(((((((((((((.(((.(((..(.(((((((..............(((.....)))....((((.((((((((..(((((((....(((.(((((((((((.(((((((((............))))))....(((....((((((..........(((((....(.((.((.(((((..(((....(((.((.((....))))...)))..)))))))).)).))))))))....((((.....))))..........(((((.((((((..((((((........)))))).((((((((((((..(.(((((((((.(((((((((((((((((((((((((.(((.((.(...((((.((.((((((((.........((((.(((((((((.....((((((......(((((((((((((((...))))))))))))..)))..))))))....(((((.....))))).(((((((..((((.((((.....))))(((((........)))))....)))))).)))))..(((((...)))))..)))))))))))))........))).))))))))))).).)).))))))).))))))))..(((((.........))).)).((((((((((.(((........)))((((.(((......))).))))...((((((((((((((((((((((((((.((((.(((((((((((((..((.((((((.....((((((.(((.(((((((((..((((((((((((((((..(((.((((..(((.....((((((..((.((((..(((((.(((((.......)))))..))))).((...(((((.((((((...))))..)).))))).)).((.((.((.......((((.(((((((((((.((((((.((((((.(((((((((((((.(..((.......(((....((((((((((..(((.(((((...((((((....((((((((.....((((((((((((((..(((.((.(((((((.........(((..(((((((......((((((((((........))))).))))).......)))))))..)))..))))))).)))))..))..))))))))))))(((((((....(((....(((.(.((((((((....(((..(((((..(((((((.......)).)))))..))).))......)))..((((((((.(((((.....))))).....((((........))))......)))))))).......((.(((((.((.((...(((((((......)))))))..)))).)))))))..)))))))).)..)))))).)))))))))))))))........(((((.....)))))......))))))))))))).)..))))))))))......))).))..)))))))))))..))).)))))).)).)))).)).)))))((((.((((((((.......................)))..))))).))))..((((((((.......(((...((((((((.((((.........)))).)))))).))..))).(((((((.((((......((.(.(((((((.........((((((.(((((((((((((((..((((....))))......(((((((((((((((((.....((((...(((.((.((((..((((.((...)).)))).))))..(((((((......)))))))...)))))...))))....))))).........)))))))........(((((.(((.((.((.......)).)).((.((.(((((..(((((.((((.....)))))))))..((.(((((((..((((((((((((((((((((((..(((((.((((..(((((.(((.......)))..))))).))))..))))).....))))))).)))))).)).....(((..((((....))))..))).(((((.((....)).)))))................((((((......))).))).........))))))).))))))))).....(((.((((((....((((((((((.(((((((....))).....(((((((.(((.....))).)))))))..)))).)))((.(((((.(((((((((((..........)))).........))))))).))))).)).((.((....)).)).((..(((((........)))))))......((.((....)).)).(((.((((((((.............)))))))).))))))))))))))))....))).....(((((((((..(((.....((((((((((((.((((((..........)))))....).))).)))))))))..)))..)))))))))))))).)).))((((((.((.......((((((...)))))).......))))))))....((((......)))))))..)))))...))))))))))).......))))))))).))))))...(((((....)))))..((.((....)).)).......)))))))).))((((((((((((..((((((.((((((.((((......)))).).......)))))))))))...((((....)))).))))))))))))...)))).))))))).((.((.((.(((((....((....)).......))))).)).)).)).((.(((......((....))......))).))..))))))))...((.((....)).)).((.(((........))).))(((....))).....(((.((....)).)))......((....))..........)))))))).......)).)).))....((((.((.(.(((((........)).))).).))...))))...))))))..))))))))).)))).).)).)))))...))))).))))))...)).)))))))...))).))))))))))))))..)))))))..(((((.....)).)))..((((((....................))))))((((.(((((((.(((((((((((.........))))))))..........((.....))))).)))....)))).)))))))))).)))))))))))).)))))))..))).)))).))))...((.(((((((((((((....((((((((...((....((((....))))....))))))))))..((((..(((.((....))..)))..)))).......((((((((((.((..((.(((((..(((...(((.(((...))).))).))))))))..)).))))))))))))(((((((((((((......))))))......(((((((...))))))).......(((((........))))).))).))))(((((.((..........)))))))..............(((..(((((((........)))))))..))).)))))))))))..)).))....)).))))))))...((((...))))))))).))))))))............((((.((.((....)))).)))).((.(((((.(((.(..(((.......))).).))).))))).))...(((.(((.....))).))).)))))).....((((.((((...))))..))))))))..))))))))))))..)))))).)))))....((((((((..(((.....)))..))))))))))))))..)))((((..((((((........)))))).))))((((((.((......))))))))......(((((.(((.....))).)))))........))).)))).))))))))))....))))....)))..)))))...)))))))...)))))))...)..)))))).).)))..))))...)))))....))))))).)).))))))))))))))))..))))))))))).....)))).)))))))..((((.(((....)))..))))...((((((...))))))(((((((............))))))).......((((..(((((..(((((.((......)))))))..)))))..))))))))))).)))))))..(((....(((((((..(((...((........))..))).)))))))....)))..))))))).))..))))))).....))).))..))))))))))))))..)))))...)))))).((((((.........))))))..(((((((((((((..(((((((.(((((....))))).))).....(.(((.....))).)....)))).))))))))))))).)).)))..))))))))).))....)))))............)))))))))))))).((((...((...((((.((((((((...((((....(((....)))......))))((.((((((.......(.((((...(..((((.((((((((.((((((((((......).))))((((..((.(((.((((((((((((((.(.(((...((.(..((((((........))))))..).))((((((...(((((...((((.............))))......((((((((((((..((((((((((.....)))))..)))))))))))))))))))))).....))))))..)))).)))))))))))).)).)))))..))))((((..((......))..))))........))))).))).)))))))))..).))))).......)))))))).((((....(((((......)))))...))))....))))))))...))))...))...))))...)).))))))..))))...))))))))))).)))).)).)))))).)))......((((((((((((..(((((......(((((.(((((((((((....((((((.((((((.((((((.(((...(.(((((.........(((.(((((((((.((((((((((...)))))))))).)))))((((((((((((((.(((.((((((((((((.((((((((((((.......)))))....)))..))))))........(((((.(((...((((.(((((.((...((((.(((....)))...)))).)))))))...))))...)))))))).......(((((((.((.((..((((.((..((.(((..((((((((((((.((((((((((((.((((....((.....)).....)))).))))))))))))))).))))))))).))).))..)))))).....)).)).)))))))...((((.....)))).))).)))))))..))).))))))))).)))))((((.......))))...((((((((...((((((((((.......(((((((....((((..(((......))).((.(((((((.......((((((((((................((((((((...)))))).))((((((((((((((.(((....((((((((...........((((((((((..(((((((((...((.(((((((((((((((.((((...............)))).....(((((........)))))((((.....((.((((...((((.............))))...)))).))...(((((((((((..((((((((((..((((((((((((................((((..(((((.....(((.....)))..........(((.(((((..((.........))..))))).)))(((((((((((.......)))))).....)))))..)))))..))))..)))).))))))).)...)))))))))).....((((((((.((((.(((.((((((((((....))))..)))))).).)).))))..)))))))).........))))).))))))..(((.((((((....)))))).).)).....)))).((((((...(((((((.......)))))))...)))))).))))))).(((.((...((((((((((((((.((((.((..(((....)))((((.(((.(((........))).)))...))))((((.(.((((((....(((((((((.....((.((((..(((((...((((........(((((.(((....).)))))))(((((.((((.......)))).)))))(((((.....)))))))))...)))))..)))).))((((((...)))))).(((((.....)))))(.((......)).)((((((..(((.(((...((.((.((........)))).)).....))).))).))))))((((((((.((...)).)))))))).......)))))))))...)))))).).)))))).))))))))))).)))))))...)).)))))))..))))))..)))))))))))))))).....)))............)))).)))).....((((((.......))))))..))).)))..((.((((....)))).)).((..(((.(((((((.(((....(((......))).....)))))))))).))).))..((((.((((.(((((.(..((......))...).))))).).))).))))((((......)))).))))..))))).)).)))))))))).(((.(((((.((..((((((.((((.((((.....(((..(((((((..(.(((((..................((((((.(.((.(.((....)).).)).).))))))............((((.((......)).)))).....................))))).)..)))))))..)))...))))))))...))))))..))..))))).)))))))))).))............)))).(((((((.((((((......((.((.((......(((....)))......)))).)).....))))))..)))).)))........)))))))..))))))).)))..))..))))))......(((((.((((((((....((((.(((((((((((..(((...))))))))....(((.(((..((...(((.(.....).)))..((.(((((((((((((((............)))))))))...)))))).))))..))).)))...))))))))))..))))))))..)))))...........))))))).((((.......))))...))))))...))).)))))))))))).))(((...((((....)).))...)))......))))..))))))))))).))))).............(((((((((((....((((((((.((((((((.......)))))..........))).))))).)))))))))))).))...((.(((....((((.(((((...))))).))))))).))..)))))))))))))...)))).)))))))..((((((.((((.....))))))))))((((((.((.((((((((.((((((((((.((....(((((...))))).))))))....)))))).)))))...((((((....)))))).......))).)).))))))))))))....)))))..)))))....))))...))))).)))))))))....)))))))).....((((((....))))))))))).)))).)))))).).)))...)))))).((((......))))))).))))).......((((.(((((........)))))...)))).........................))))))))....)))..)))))))....))))))....((((.((((((..(((((((((((((((..........((((((....((((((((((((((((((...((((......((((................))))....))))...)).))).))..))))))))(((((((((((((((....)))).))))))))..))))))...))))))((((..((((..............(((...(((((((((((.((((......((.((((...))))))...(((((.(((((((...(((.((((((((.(((...........)))))))).))))))))))))).))).)).........)))).))))))))))).)))............))))..))))..((.(((((.(((((((((((((((.(.(((((((.(((..((((((((((......(((........))).....))).)))))))(((((((((.((..(((......))).)).)))))))))))))))))))).))))))).....))))))))...))))))).))).)))..)))))))))..)))))).)))).......)))).))..)))).))..))))).))))))).))))))))))))(((((((...((.(((.((......)))))..))...))))))))))))))).)))))))))).)))))))....))))))).)))))))))))))))))...............)))))))(((((((((((.(((...(((((.(((((((..((..((((((((((((((((((((((.......(((((.((((..(((....(((....)))....((((((((((((((((...)))))))).......................((((.........)))).((((((((.(((((((....(((((((((((((...))))))))....)))))...))).))....((((....((((((((((.....(((..((........))..)))((....)).....))))))...))))..))))....))))))))))((((((..((......))..))))))))))))))....)))..)))).)))))....)))))).)).))))).)))))))))....)))))))))...)))))))).))))).)))))))))...)))))..))))))))).)))))).))))))))).))))...............)))).)))))).))))))))...)).)).))))....))))))).)))..)))))).).)))))))))).)))))....................)))))))..))).).)))))))))))))))))))))).))).))))((((((...((((((((((((...(((((((((((((((.(.(((((((..((.((((((((......((((((..(.((..(.((((((((.((((((.....((((((((((((.((((.............)))).)).....))))))))))..(((((......(((....)))...))))).........((((.((((((((((((((((...((((.((((..(((((((....(((.((((((((((...((((((...)))..)))...)))))))))).)))(((((....))))).)))))))))))))))...))))).(((..((((....((((.(((((..((.((((...((((((((.(((((....(((((..(((((((.(((.....(((((........)))))))).)))))))...)))))(((.((((.((((.((...)).))))...)))))))(((.(((.....))).))).))))))))))..)))..)))).)))))))))))....))))..)))((((.(((.....((((.(.....)))))))).)))).........))))))))....))).))))))))))...)))))))).)))).))))))......)))))))).))..))))))).))))))....(((((((..(((((((......(((((...)))))))))))).))).))))...))))))).)))...))))))))))))...)).)))))))).......)))))).))((((.(((((((((((((...((((.(((...(((...))).)))))))....)))))..)))).))))..))))..)).)))))....))(((((....(((((((.......))))))).....)))))...........

Transcripts

ID Sequence Length GC content
GCCGCUCCGCUCCAACACAAAAUAGGGCCGCCUCUUCUCCUUUCUCCCC… 20635 nt 0.5978
Summary

The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010] CIViC Summary for KMT2D Gene

Forensic Context

A study in humans demonstrated that the KMT2D gene, a lysine methyltransferase involved in chromatin remodeling, was differentially expressed in subcutaneous adipose tissue in a sex-specific manner during obesity, being upregulated in females with greater BMI but downregulated in males [Haltia et al. DOI:10.1002/oby.70078]. Separately, a forensic study in humans developed an RNA typing system for individual identification from hair shafts, where the KMT2D gene harbored coding SNPs (rs11168830 and rs2241726) that were part of an 11-gene multiplex assay with a combined discrimination power of 0.999969, showing 100% concordance with DNA typing and species specificity [Liu et al. DOI:10.1016/j.fsigen.2023.102929].