| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUUAACCUUUGGGAACAAGGCAACUAGCGUCUGGCAGCAGGAAUCCAA… | 2093 nt | 0.4482 | |
| AUUUAACCUUUGGGAACAAGGCAACUAGCGUCUGGCAGCAGGAAUCCAA… | 4198 nt | 0.4204 | |
| AUUUAACCUUUGGGAACAAGGCAACUAGCGUCUGGCAGCAGGAAUCCAA… | 1985 nt | 0.4504 |
This gene uses alternative splicing to generate two different proteins- high molecular weight kininogen (HMWK) and low molecular weight kininogen (LMWK). HMWK is essential for blood coagulation and assembly of the kallikrein-kinin system. Also, bradykinin, a peptide causing numerous physiological effects, is released from HMWK. Bradykinin also functions as an antimicrobial peptide with antibacterial and antifungal activity. In contrast to HMWK, LMWK is not involved in blood coagulation. Infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) reduces or depletes angiotensin converting enzyme 2 (ACE2), which results in an increase in levels of des-Arg(9)-bradykinin, a bioactive metabolite of bradykinin that is associated with lung injury and inflammation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2020]
A study in humans demonstrated that the KNG1 mRNA level in peripheral white blood cells correlated with spinal cord injury severity and was identified as a potential diagnostic biomarker for this condition [Kyritsis et al. DOI:10.1084/jem.20201795]. In a separate human study, the KNG1 gene was downregulated in kidney tissue as part of the inhibited haemostasis pathway in patients who succumbed to septic shock [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938]. A study in mice demonstrated that the KNG1 (Kng2) was significantly upregulated in the inguinal white adipose tissue of adult burn mice seven days post-injury, where it was associated with the kinin-kallikrein system regulating inflammation and vascular permeability [Bhattachan et al. DOI:10.1096/fj.202501420R]. In a separate study in rats, the KNG1 (Kng1) was found to be significantly upregulated in liver tissue on day two following a 20% total body surface area burn injury, with its expression validated by quantitative RT-PCR [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].