Basic Information

Symbol
KNL1
RNA class
mRNA
Alias
Kinetochore Scaffold 1 CT29 Cancer/Testis Antigen 29 KIAA1570 AF15Q14 HSpc105 PPP1R55 HKNL-1 CASC5 Spc7 D40 Cancer Susceptibility Candidate Gene 5 Protein ALL1-Fused Gene From Chromosome 15q14 Protein Protein Phosphatase 1, Regulatory Subunit 55 Microcephaly, Primary Autosomal Recessive 4 Outer Kinetochore KNL1 Complex Subunit KNL1 Blinkin, Bub-Linking Kinetochore Protein Cancer Susceptibility Candidate 5 Kinetochore-Null Protein 1 MCPH4 Kinetochore Null 1 Homolog (C. Elegans) Bub-Linking Kinetochore Protein Kinetochore Null 1 Homolog Protein D40/AF15q14 Protein CASC5 AF15q14 Blinkin
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_144508.5
Sequence length
9266.0 nt
GC content
0.3761

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2461.90 kcal/mol
Thermodynamic ensemble
Free energy: -2647.67 kcal/mol
Frequency: 0.0000
Diversity: 2047.78
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((......((((.((.((.......)).))))))((((((.(((......))).))))))(((((((((.((....)).)))))((((((((.........))))))))....(((((((.((.......)).)))))))...((((((((((........(((((...)))))........))))))))))..((((((.(((((..(((((....)))))..)))))..))))))...(((((...(((((((....)))).)))...)).)))((((((((((((((((((..((((((((((((....(((((((((......(((((.((((..(.(((((.(((((..(((((((((((((((......((((...((((((((((((.....((((..(((((((...((((((((....)))))))).............(((((.....))))).((((...((..((((((((((......((.....)).....))))).)))))))...))))(((((((((......(((((((((..((......))(((.(((((((((.........((((((....))))))......(.(((((.((((.....))))((((.....(((((.(.(((....))).).))))).....))))....))))).).(((..(((.....)))...)))((((.......))))(((((...((((.....(((((((....((.((((((((((..(((........)))(((((((((((((........(((((((..............))))))).((((((((.((...))))))))))...((((((((..(((......((((.((.((((.((((.(((.(((.......((((.((((((((((((((...((((..((((((...)).))))((((((((((.((((((((((((((......((((((((((((((((..(((((.(((.(((..(((((...(((((((((...((...(((((((.......(((((.....)))))))))))).....))...))))).........)))).)))))....)))...))).))))).......((((((((..(((((((...)))))))...((((((...............))))))..((((((.(((....)))..)))))).............(((((.......(((((.(((((((..........))))))).))))).)))))......))))))))..............(((.((......)).)))(((((((.((....(((((((.(((..((((.(((..(((((..((((((((((...((....))....))).)))))))....))))))))))))..))).)))))))((((((((((((..(((.....((((.((...(((((...(.(((((((....))))))).)..(((((((((....(((((((......)))))))...((.(((((((((...((((((((((((((((((.(.((((((....))).))).))))))))).)))))).))))...............))))))))).))...)))))))))..................(((((.........)))))............(((((((.((((((....(((((.(((.....))).)))))((((((((((((((...(((((.((((((((((..(((((((......)).)))))..)).(((((((((((((..(((...((((((...((((((...(((......)))))))))))))))))).)))))))))...((((.((....)).))))((((....((((((((((....(((........)))...))))(((((((((((..((((.(((((((((....))))).........(((((((((..........(((((..((((....)))))))))........(((((((...((((((...((....(((((((..(((((.......((((............))))...(((....)))(((((((((((((..(((((....)))))..).(((((.((..((((((((((((....(((((((((((((((((((........................)))))..)))))...........))))))))).........(((((.((((....((((..(((((....)))))..((((((...))))))..(((((......)))))...((((((.........))))))))))..)))).)))))(((((((((.(((.((....((((.(((((((...............(((((.......))))).....(((.(((.....))).)))..((((((((((((...((((((.(((((((..........(((((...)))))))))))).........)))))).......))))).)).))))).(((((.....)))))......))))))).))))............))))).)))))))))...)))))))))))).))))))).((((.......(((((....(((...((((((((......(((...))).....)))))))))))...(.((((((((..((..............(((((((((........(((..(.((..(((((....))))))).)..))))))))))))............((((((((((((...((((((((((((((((((((.....(((((......................(((((..((((((..((((.(((......)))...)))).....))))))....)))))...))))).)))))))))......((((.((((((((((......)))))).)))))))))))))))))))...)))...)))).)).))).....((((((((.((..((.........))..)))))..)))))......(((((........)))))..........))..)))))))).)....))))))))))))))))))))))))))..)))))))..((((.(((.(((((.((((((((((..........((((((...((((((.(((....((((........))))))).))))))))))))...........(((((((..((.((((..(((((..(((((...)))))........((((.((((((((.....((((..(........)..)))).......(((.....)))........((((.....))))...))))))))(((((....)))))...........))))..))))))))).))..)))))))...((((.((((.........)).)))))).(((((((((((((............((((((((((....((((((..((((.(((......)))...)))).....))))))..))))))))))..))))))))))))).....))))))))))...(((((((.......)))))))(((((.((....)).)))))...)))))...)))))))..(((((((.(((.((....))...))).)))))))............((.......))..(((((((.(((((..((....)).)))))))))))).)).....))))))............(((........)))..)))))))..............)))))))))....((....))((((.(((((((((.(((....)))........(((((((......))))))).(((((....(.((((...(((((...((............)).)))))...)))).)....)))))...((((((((((((..........((((((.......((((((((((((.((((((((......)))))).((((((((((((((((((....((((((....((((((((((..........)))).)))))).((((((((....((((((((.(.....).))))).....)))....))))))))...(((((((.((.((((....)))))).)))))))))).)))))))))).(((....((((((.....))))))...)))((((((((((.((..(...(((.......)))....)..)).))))))))))......(((((.........)))))..(((((.....)))))..)))))))))))..((((..(((((.......)))))..))))....(((((..(((((.....((((....((((.....))))....))))..)))))...)))))...))))))))))))))(((((((....)))))))......(((((((((.............(((.....(((.....)))...))).......................((((((((..((((((((((.((((((....((((((((............(((......))).................((((....))))(((((.(((.((.(((.((.......))..))).)).))).)))))..........)))))))).))))))..)))))))..........(((((.......................)))))..(((((((((.....(((...)))..........(((((((..((((((((.((((.............((((((.((((((.(((((((((....)))))))..)).)))))).)))))).........(((....(((......))).....))).......((((...(((.....)))...))))..))))..)))).)))))))))))......)))))))))..)))..))))))))))))))))).........((.(((......))))).........))))))........))))))))))))......))))))))).))))..((((((((((........))))).)))))...))))...)).))..)))))))))))....(((((.(((((((.(((((((......)))......................(((.(..(((.....)))..).))).))))))))))).))))).....))))))...))))((((((((((((...(((((...))))).))))))).....)))))....((((((((..(((((....)))))..)))))))).))))(((..(((........)))...))).((((.((((...........)))))))).....((....)).......)))).)))))))))......(((....)))...............(((.......)))........(((((((((..((((......((((((((((..((((((((.(((.((((.(((((((....(((((.......)))))....(((((((((((((((((((......(.(((((.((((.......(((((((..(((.((((((.((((......(((.(((.(((..(((((((((....(((((.......))).)).....)))).)))))..))).))).)))((((...))))....(((((((..........(((..((((.(((.......((((.......))))))).))))..)))..........))))))).((((((((.(((((((........((........))..(((((.((..(((............)))..)).)).))).)))))))..)))))))))))))))))))))....))))))).......))))..))))).)....(((((((..((((((((((................(((.............))).(((((.....)))))(((((((.(((((...(((((((...((((((......))))))...)))))))))))))))))))....((((((...(((((.(((.(((((((((((((.....))))))........((((......))))......(((((((((((((((((((.....................(((..((.(......)))..)))...((((....))))(((.(((.(((((.....(((((((......)))))))(((......)))(((((.........(((((((.((((...(((((((((((((((((((.......((((((.......)))))).......((((((....)))))).....((((((((.....((((.(((.....((((((............))))))..(((((((((((.((((.(((((((((((.(((.........))).)))))).........)))))((.(.((((((.(((.(((....))).).)).))))))).)).)))).)))..)))))))).......((((((((.......))))))))..))).))))..)))))).)))))))))).))))......)))))))....))))....)))))))...........(((((.((.((.((.......(((((.(((.((((((..........))))))(((.......)))..))).)))))...)).)))).)))))((((.(((((...((((((((......((((.............)))).......)))))))).......(((((........))))))))))..)))))))))....((((((((......)))))))))))))))).))).)))))))))).....................(((.((((..((((.........))))..)))).)))....)).)))))))....))))).)).)))............((((.(((((((((((.((((....)))).)))))...))))))...)))).)))))....)))))).(((....)))..))))).)))))..))).))))...........))))))......))))))).....))))))(((((((((.(((..((((...))))))).)))))))))(((((.....))))).....))))))))))).)))....))))))))))))))).((((((((((......))))))))))............(((((((.((((....(((((.(((.....((((((........)))))).....))).)))))....)))).))))))))))((((......))))..........))))))))))))).....)))))...)))))))))...........)))).)).))))))).))))))))))).(((((...))))))))..)))))))))))).)).))))))).....))))))).)))))))))..........(((((((((((((((..((..((((((((.((((((((((((((((((..((((((.((((((((((......(((((.((.((..(((..(((((..((.((((((.(((((..(((((.(..((((((((..(((((.(((((.(((((((((((((.(.((((((((...((((((((((((((((((((((.((((((..((((((((((((..(.((((((((((((((.(((.(((((((.(((.((((.(((.(((((((((((((((((.(((.((((((((((((.((((((((((((((..((.(((((((((((((((((((.((.....(((((.(((.(((.((.......)).)))...)))))))).....))))).))))..)))))))))))).)))))))))))))))).)))))))))))).))).))))))))))))))))).))).)))).))).))))))).))).)))))))))))))).)..)))))))))))).)).)))).))))))))))))))))))))))...)))))))).).)))))).))))))).))))).)))))..))))))))..).)))))..))))).)))))).))..)))))..))))).)).))))))))))....))))).))))))..)))))))))))))))))).))))))))..)))))))))))).)))))...(((((....))))).............)))))))).............)))))).))))))))))))))...)))))).)).)))))).)))).......))).))).)))).)))).)))))))))))).))))).......)))))))))))))....(((((((((.....((((((...............((((((..........))))))..........((((............)))).......)))))).)))))))))((((.((........)).)))).....(((((((((.((((........)))).))))))))).........))))))))))))....)))))))...))))...)))))....(((((.((((((......)))))).)))))..))))))))).)))((((.(((((......)))))..)))).((((((..((((((((.......)))...)))))...)))))).........(((((((((((((((((((.((((((....(((....))).....))).))).)))).))))............)))).....))))))).....))))))))).....)))))))))...............(((((....)))))))))))))))).............))))))))))))...)))).....)))).....((.((((((((((((((.(((.((((........))))...)))((((((((.(((.....))).)))).))))......)))))))))))))).)))))))))))))....))))).))))).)..))))))))).)))))))))..))))))))))))...............)))))))).....))))))))))....)))).(((((......)))))..........)))))))...........
Thermodynamic Ensemble Prediction
...,{({{,...,||.(((((((...(((.(((((.((((((({(,(((...,}}))),))}}|(((((.......))))))))).))))).)))((((((..({.{,({(((((((.(((......})}.))))}}}))))|{{{,...}}}}},,.....})..))))))}})}}))).,(((((((((((({{...((((((.(((((..(((((....)))))..}))))}.))))))...(((((...(((((((....))))}}))...)).)))..((((,,,,||}|,,,,..((((((((((((....(((((((((....,.(((((.((((..(.(((((.(((((.,(((((((((((....((((((((....}}|}))))}..,{{,,..{{({..{{{{{{{,..(((((((,..,,})))}}}}.{,,,,,,.,,,,{{{{|,,,,.},,,,.((((...,...((((((((((......((.....)).....))))).))))),}...))))(((((((((.,....(((((((((..((......)),{{.(((((((((,.......,{{{{{{,,,,,}}})),,....{.(((((.((((.....)))}((((.....(((((.{,((,....})}.).))))).....))))....))))}.,.{({,.(({.....}}}...}}}((((.......))))(((((...((((.....(((((((....(,{((((((((((..((({{{{{{((((.(((((((((((((........(((((((..{{,......,}}))))))).((((((((.{{...}}))))))))...((((((((..{((......((((.((.((((.((((.(((.(((.......((((.((((((((((((((...((((.,((((({...,},})))|(((((((((.((((((((((((((,,,,,,(((((({{(((({((((.(({...}}},||{{((((,,...,..........}}}}}}(((((((.......(((((.....)))))))))))).,,,{||,{{|,,,|{{{.,{((((((({,{{{,,...{{{...{{,,,,.,,.,,....,{(((((...,{{{|||,,,}))))},...((((({....||....,....))))}}})))}))}}}}}},...{{({{(((((({.....,.....|{,,,.......(((((.{((((((..........))))))).})))).,))))))},.}}))),{{{{{..{{{{{{{{{.((({{{{{,{{{,,.{{,(((((((,.,,,..(((((((.(((..((((.{{{..(((({..((((((((((...((....))....))).))))))).,,,)}}}}}}}))))..))).))))))).,(((({{((((((((..,,....|,{((......}},....(((((((....)))))))(((({{{{(((({,...(((((((......)))))))...{(.(((((((((...((((((((((((((((((.(.(((,({....,)).))).)))))))))},))))).)))).......|,......))))))))).))...}},}}}}}}......,,..........(((((.........)))))..............},,,}..,.))})...{((({.(((.....))).,))))((((((((((((((...{(((,,((({(((({{,.(((((((......)),,)))).,||,((({(((((((((..(((...((((((...(((((({..{{,......)))))))))))))))))).)))))))))...{(((.((....)).)))}((((..,.((((((((((,(..(((........)))..,))))(((((((((((..((((.(((((((((....))))),,....},.(((((((({{((((,....{{{||,,|,.....{(((((((((..,,,...,,{{{.....{{{(((,.,((....(((((((..(((((.,,,...((((............))))...|||....}}}(((((((((((((..(((((....)))))..),(((({,({..((((((((((((...,({(((((((((({{(({{,........,||...,,.....,,{|||||,{|||||,..,,||||..}}}}}}))),,,......((((({(,{((,...,||},,|||}}},.}))))}}||||{|,..}))}}}..(((((......))))){{.((((((.........)))))).))}|,)},,}),,,,(((((((((.(,((((....((((.(((((((.....,.,...,.,.{((((.......))))}.....{((.(((.....))).))}..((((({((((((...{((({{|{(((||,.....},},.{{(({...,}}},.,|||......,....))}}}},,,....))))),.}.))))).,{{||.....))))}......))))))).))))............))))}.)))))))))...)))))))))))).}}))))).{({(,....,.(((({....(((...((((((((......(({...})).....))))))))}}}...(.((((((((..((..............(((((((((..,.....({{..{.{{..(((((....)))))}}.,..)}})))))))))............,,,{{{{,{(((...((((((((((((((((((((,{...|||{(.....,,|{{.{{..((((((((.,.(..((((((..((((.{{{,.....)),...)))).....)))))),,,.)))))))),,)),,))))))))),.....((((.((((((((((......)))))).))))))))}))))))))))...))),.,},}}{||,||}.....((((((((.((..{{....,,...}},,,}}}},})},}}......|||||.....,,,,,,|||.....,,,.))..)))))))).)....}))})))))}))))))))))))))))..)))))))..{|||,{{(.((({{.((((((((((...,,.....((((((...((((((.(({...,((((........))))))).))))))))))))....,.|....{((((((..{{.{(((,,((((,..(((((...)))))......,.{{{{.(((((((,.....((((..{........),.)))).......(((.....)))....{{,.{(((.....)))),}})))))))}(((((....))))).,||.......))),..))))},)))|)}..))))))}.,.,{({.{,((.........}}.)})))}|(((((((((((((............((((((((((....((((((..((((.({{,,....)),...)))).....)))))).,))))))))))..))))))))))))).....))))))))))...(((((((.......))))))}(((((.{,....}}.}))))|,,)))}}...))))))).,|||{{{{.{{{.{{||..,}..}))).}}},,}},}}.........((.......))..(((((((((((((..((....}}.)))))))))))).}}.....}))))),}}...,..}))))))))}....,||..}})))}}.,,........,,,)))))))))....{{..,,|,((((.(((((((((..,.,,..|||.....,,,(((((((......))))))).(((((....{.((((...(((((...((............)).)))))...)))).}....)))))...((((((((((((..........((((((.......{(((((((((((.{,((((((......)))))).{(((((((((((((((({..{(((((((....((((((((((,{........,)))})))))).((((((((....((((((((.(.....).))))).....}))....))))))))...(((((((.((.((((....)))))).)))))))))).)))))))))).(((....((((((.....))))))...))){(((((((((.((..,...({{,,.....)))....}..)).)))))))))}......(((((.........)))))..(((((.....)))))..))))))))))}..{{{(,,(((((.......}}}))..}))),},.(((((..(((((.,..,{,,{,,{.,{{{.....}))),..,}},...)))))...)))))...}})))))))))))}(({(((,,,,.||||,||{{(((.,(((((((((,....,,.....{{(.....(((.....)))...}}}..,,.,,......},,},,,,..((((((((..((((((((((.((((((....((((((((.....,,.,{,,((,......}}}....{{{{{{.......((({....)))),,,}|}|||},|,{||.{{,,.....,,..,||,|,.,,....))),.........)))))))).))))))..))))))).,{,.,,...{{{||.,,.......|}}......,,..,})},..(((((((((.,,,..,{,..,|||....,,},,{{{((({..{(((((((.((((.............((((((.((((((.(((((((((....)))))))..)).)))))).)))))).........,,({{{.{,,,,,...,)))..,,,))},....,{{{{...{{{....,|||...))))..))))..)))).)}}},}}}}}}......)))))))))..)))..))))))))))),)))))},,,,,.,,|})}}}....|{|}},}....,},..))))))........)))))))))))),,....))))))))).))))}}|(((((((((........))))).))))}...))))...)).))..)))))))))))....(((((.(((((({{((({{{{......}||,,....,}}.....,.......(((,{,,({{.....))),,}.))).,)))))))))).)))))...,.)))))),..)})}((((({((((({...{((((...,}))),)}))))).....))))}....((((((((..(((((....)))))..)))))))).}}}}{|||.{{{,,......}},..,|||.((((.((((.{.........))))))))..|||({....}},......}}}}.))))))))}......,,,....))).....,.........{(,.......}}},.,,..{,{{((((((,.,((((.,{{({(({{||{||||.{((({(((.(((.{((({(((((({....{((((...,,,.))}}),,,.{{{{{{(((((((((((((......{.(((((.((((.......(((((((..(((.((((((.((((,{{{{,(((((((.(((..(((((((((....(((((.......))).)).....))))}}))))..))).))},)))|{{{...||||,,,{((((({{.......,..(({,|{|||,|||..,|}|||{{{|,..,}})}}},}}.||||..}|}....|{,...))))}),,|{{{{{{{.{{((({{........,,,,..{{{..,..|||,{,|{..{{{..,,,.,,},..}}}..}}.)).}}).}))}}}).,)))}}))})))))))))))))....))))))).......))))..))))).|....(((((((..((((((((((.,...........,,.((((,......,{,{.,,,.(((((.....)))))(((((({,(((((...(((((((...((((((......))))))...))))))))))))))))))),,,.((((((...(((((,{{{..{(((((,(((((,{,,,{|||||{.(((((.(,((({{...||||......||,,,{,{{((((((((((.....,...............{{{.{((.,.,,},.}},..}}}...{{{{....})}}(((.((,{(((((....,(((((((......)))))))|({.....,}||(((((.{,...,,.,{{{{{,.{(((...({{{(({((((((((((((....,..{(((((.......))))}}.......((((({....}))))).......{{({,{......,,|.||......((((((....,..,,,..))))))..(((((((((((.(((({((((({(((((,((({{..,,...,}},)}}))),,,.,.,,.)))))}{.{.((((((.(((.(({....))).).)).))))))}.},.)))).}))..)))))))).,,...,((((((((..,,,..}})))}}),})))}),}}.,||}}}},}}})))))))}}))).,,..,))))))}....}}}}..,,|||||||.{,{{......}|{|....))}}}}},.,...{|{||.,,{.((((((..........)))))),|..,...{|||,.,|||.||||}.,,,)}))}.{{||{{.,,)))}}},|||{{({((({......((((.............)))}.,.....)))))))),,,....,,,,,,,|}}}.,}}}}})))}}..}))}))))}....{(((((((......)))))))))))))))).))).)))))))))),,.....}.,))))}.}))))).},{(((..((((.........))))..)))}.,||{,,.||{|||,||}..,,|}}}}.}},}}.....,,....,.|||||||||{{{{({{.{{{{....}))}.)))})...)}})))})}}}},.)))))....)))))).{{,,,,,,))..)))))}}})))..))).))))...........)))))}.....,)))))))..,,,}}},,,(((((((((.(((..((((...))))))).))))))))){{{{(.....))))}..,..})))))))))).)))..,,})|||||},||||,,.((((((((((......)))))))))).,}},.,))))},{(((((.|(((,,..{(((|.(((.....{(((((........)))))).....))).)))))...,)))}.)))))},,,,{(((......)))}..........)))))))))))))}....}))))...))))))))))))})))))}}))}|||},}}}},}}}}}}|||.}|||,}}})))}.}}}}}}})))))))}))),,.}))))),))))).,,..,})))))}}))))))))....,,,...(((((((((((((((..{{..((((((((.((((((((((((((((((,.((((((.(((({{{((((....,(((((.{,.{(.,(((..(((((..((.((((((.(((((..(((((.(..((((((((..(((((.(((((.(((((((((((((.(.((((((((...((((((((((((((((((((((.((((((..((((((((((((..(.((((((((((((((.(((.(((((((.(((.((((.(((.(((((((((((((((((.(((.((((((((((((.((((((((((((({.,{(,(((((((((((((((((((.{{...,.{{(((.(({.(((.((.......)).)))...)))))))).....))))).)))),.}))))))))))).)})))))))))))))).)))))))))))).))).))))))))))))))))).))).)))).))).))))))).))).)))))))))))))).)..)))))))))))).)),}))).))))))))))))))))))))))...)))))))).,.)))))))))))))).))))).)))))..))))))))..).)))))..))))).)))))).))..)))))..))))}.,}.)))))}....))))))))).)))))).,)))))))))))))))))).))))))))..),)))))))))),,)))),,}}||||}}}}))||,.............)))))))).............)))))).))))))))))))))...)))))).)),}))))).)))).......))).))).)))).)))).)))))))))))).))))).......)))))))))))))}}}}|((((((((.....,{{{{{...,...........((((((.,,....,..)))))).......,,.{{{|,,..........}}}}.,|,,,.}}}))).))))))))}|,{,,||,...}))),)}))...,,..(((((((((.((((........)))).)))))))))....,.,..))))))))))))....)))))))...))))...)))))....(((((.((((((......)))))).)))))..})))))))).}},{(((.(((((......)))))..)))}.{{((({..((((((((.......))),..)))))...))))))....,,...(((((((({(((((.((((.(((((({{..(((....)))..}},)))}})).)))).))))}.........,,,.......}))))))).....)))))))))...,.))))))))).,,......,,,...{((((....}))))))|||||}}},}}}}}......{{||||||,,,,.}}}}))}}}}}}})))))}}..,(,(((((((((((((,.{((,{(((........)))}..,|||((((((((.(((.....))).)))).))))...}},)))))))))))))).)}))))))))))).,..))))).))))).)..))))))))),)))))))))..)))))))))))).....{|||{..,..,,,,)})}}.,}))))))))))))))}.,...(((((......)))))..,.......,{{||.....,,}},...

Transcripts

ID Sequence Length GC content
AGAUUUGAAUACUUCACUGAGGCGAGCCGGGCGUUGUGAGCGGACUGCU… 9266 nt 0.3761
AGAUUUGAAUACUUCACUGAGGCGAGCCGGGCGUUGUGAGCGGACUGCU… 9344 nt 0.3778
Summary

The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]

Forensic Context

A study in mice demonstrated that the KNL1 gene was upregulated in common in white blood cells at day 1 post-injury following both burn and trauma-hemorrhage, being identified as a gene expression marker associated with cell death pathways [Lederer et al. DOI:10.1152/physiolgenomics.00086.2007]. In a separate review of myocardial infarction models, the KNL1 was reported as a marker for injury stress-response cardiomyocytes, being highly expressed in a specific mouse cardiomyocyte cluster following cardiac injury [Xinxin Bian et al. DOI:10.3892/mmr.2025.13680].