Basic Information

Symbol
KRT1
RNA class
mRNA
Alias
Keratin 1 KRT1A Keratin, Type II Cytoskeletal 1 Epidermolytic Hyperkeratosis 1 Type-II Keratin Kb1 Keratin 1, Type II 67 KDa Cytokeratin Hair Alpha Protein EHK1 CK-1 K1 Cytokeratin 1 Cytokeratin-1 Keratin-1 NEPPK AEI2 EPPK KRTA CK1 EHK
Location (GRCh38)
12:52674736-52680407
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Sudden cardiac death diagnosis Tissue/body fluid identification Wound age identification
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_006121.4
Sequence length
2451.0 nt
GC content
0.5263

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-915.50 kcal/mol
Thermodynamic ensemble
Free energy: -960.79 kcal/mol
Frequency: 0.0000
Diversity: 400.97
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((.....(((((((((((((.(..(((((....((((((...((....(((.((....)).)))))...)))...)))...)))))..)))).)))))))))).(((((((((.((((((((.(((((((.((((((.(((((..((((((.(..((((((........))))))..).))))))............))))).))))))))))))).((((((((...(((...((((((.(....).)))))).....)))...((((.((.........)))))).....(((((.(((((((((....(((.((((.....((((((((((((.(((((((((((((....(((((.((((((((..((((.(..((((((((((((((((((((..((((((((((.(((......(((..((((((((((((((((..((...((.(((..(((((.(((((((..((((.((....)).))))))))))))))))))).))...)).)))))))))))).))))..))).......((((((...(.(.((((((...(((..........)))...)))))).).).)))).))..)))))))))))..))..))))..))))..(((((((.....)))))))..((((..(((((((..(((................)))...)))))))..)))).....)))))))))))).)))))...)))))))))))))..)))))).))))).....(((((...))))).((((((((((((.((........)))))))))).))))(((((((((((((.(((((.((((((((.(((((.(((......((.(((........)))))...)))((((((.((.....)).)))))).((((((............))))))(((((......((((.(((.((....)))))..))))......)).)))((((((....)))))).(((((.((((....)).)).)))))..(((((.(((..(((..(((((........((.((((((....((((((..........((((.(((((...(((((....)))))))))).))))...((((((((((...((((((..........))).)))...))))))))))....((((((.((.(((.(((((((((....((((...((((((...((((...((((((((.......).)))))))..))))..))))))...)))).......)))))......(((...))).....)))).))).))))))))....))))))..((.((((......)))).))(((......))).)))))).)).......))))).)))(((((((..(((...(((((((((..(((....))).....)))))))))))).)).)))))((((..((....)).))))....))).)))))(((((((((((........(((((...)))))...............(((((((((.(((((.(((.(((......))).)).).))))).(((((.((((.....))))..)))))(((((((...(((((.((.((.(((((..(((((((((((((.(((((..((((((((.(.((((((.((.(((((((((((((.((.((((...)))).)).)))))..)))))))).))..)))))).)))))))))))))).)))))..))))))))))))).)).)).))))).....)).)))))..(((((((((((((((((.......(((.(((((((((((.((....)).))((((((.((.(((((....))))).)).))))))((((((.((((((.((((((..((.((((........)))).))..).))))).)))).)))))))).(((..((........)))))...))))))))).))).((...((((.....))))...))..(((((((..((((((.............((((((...(((((.....)))))....))))))............)))))).))))))).(((((((...))))))).........))))))............)))))))))))........)))))))))..))))))))))))))))))..))))))..)))))..)))))))...........)))))).)).)))))))))))).......)))))))...))))))))).)))))))))))))....)))).)))).))))))).))(((((((.((((.(((((((....(((((............))))))))))))))))..)))))))........((((.(((........))).))))))))))((((((.((((......))))..))))))..
Thermodynamic Ensemble Prediction
.((((((,....{((((((((((((.,..(((((.{.,((((((...{,,,..(((.((....}}.))}}}...})}...})).,.)))))..|))).)))))))))).,,{((((((.((((((((.((((((,{((((((.(((((..((((((.(..((((((........))))))..).)))))).......,,...))))).))))))))))))).((((({,({{{{,{{{|((((((.(....).)))))).....)))..,,|)}}}.},,,}))...{||,,..{..(((((.(((((((((....(((.{(((.....((((((((((((,,((((((((((((....(((((.((((((((..((((.(..((((((((((((((((((((..((((((((({{((({{....(((..((((((((((((((((..((...((.(((..(((((.(((((((,.((((.(,....,).))))))))))))))))))).))...)}.))))))))))))},)))..)))....,}.((((((...(.(.((((((.,{({(..........})),..)))))).).).)))).))..))))))))))},.))..))))..})))..(((((((.....)))))))..((((..(((((((..(({.....,,....,,...)}),..)))))))..)))).....)))))))))))).)))))...)))))))))))))..))))))}}))))}.|,.(((((...))))).}|((((((((({,((........)))))))))).})){(({..{(((((((.(((((.((((((((.(((((.(({......((.(((,.......))},}...}}}((((({.((.....)).}))))).((((((.,......,.,.)))))),||,,..,...{{((.(((.((....)))))..))}|,{{{{{{{{.{,((((({....})))))....}},||||.....},}}}))})}}.(((((.(((..{{{..(((((........((.((((((....((((((..........((((.(((((...(((((....)))))))))).))))...((((((((((.,.((((((..........))).)))...))))))))))....((((((.((.(((.(((((((((.,{.((((...((((((...((((.,.((((((((.......)}))))))).,))))..))))))...)))),,.....))))),.....(((...))).....)))).))).))))))))....))))))..((.((((......)))).))(((......))).)))))).)).......))))).}},((((({(,.(((...((((({((({.{((....)))}}}}.)}))))})}))).)).)))))((((..{{....},.)))),,..))).)))))((((((((((((,.(((({...})))).,)},.........,.....{({((({(,.{((((,|{{.{(|....,,|}},,}.}.))))).(((((.((((.....))))..)))))(((((((...(((((.((.((.(((((..(((((((((((((.(((((..((((((({,(.((((((.((.(((((((((((((.((.((((...)))).)).))))}..)))))))).))..)))))).)))))))))))))).)))))..))))))))))))).)).)).))))).....)).)))))..(((((((((((((((((....,{.(((.(((((((({((.((....)).))((((((.((.(((((....))))).)).))))))((((({{((((((.((((((..((.((((........)))).))..).))))).)))).)))))))).{{(,{{,...,..,.}},})...})))))))).))).((...((((.....))))...))..(((((((..((((((.,.{({,,.....,{{{{{,,}||{||.....}}|||,,.,}}}}}}....}},,,...)))))).))))))),(((((((...))))))}},,,,,...))))))............)))))))))))........))))))}}},.})))))))))))))))))..))))))..)))))..))))))))}}{(({{......)))}),.)))))))))))).......)))})))...))))))))).))))).,},,,}}.))})))),}))).)))))))..|(((((((.(((,{(((((((....{((((............))))))))))))))))..))))))),.......((((.(((........))).)))),})))}{{{{{,.((((......))))...})}},..

Transcripts

ID Sequence Length GC content
NM_006121.4 NCBI
AGAGGAGUGUUUAGCUCCUUCCCUUACUCUACCUUGCUCCUACUUUUCU… 2451 nt 0.5263
Summary

The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the spinous and granular layers of the epidermis with family member KRT10 and mutations in these genes have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the KRT1 as a potential biomarker for the early detection and diagnosis of cardiovascular disease in patients with type 2 diabetes mellitus, where it was found to be upregulated in blood samples from T2DM patients with ischemic heart disease compared to those without [Fan et al. DOI:10.1186/s12872-021-02166-4]. In a separate human study, the KRT1 was identified as a keratin marker for suprabasal keratinocyte identification and was expressed in a suprabasal cell cluster in spatial transcriptomic analysis of acute skin wound healing [Liu et al. DOI:10.1016/j.stem.2024.11.013]. A study in human tissue and swab samples demonstrated that the KRT1 was tested as part of a panel of 19 cytokeratins for discriminating epithelial cell origins in forensic sexual assault investigations [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X]. The research found that the KRT1 was only minimally or not at all useful for addressing the specific sexual-assault questions under investigation, unlike other cytokeratins such as Ck4 and Ck10 which were effective for distinguishing mucosal from skin cells.