| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGCACUCCCUGGGCUAAACAGCAUCACCAUGUCUGUUCGAUACAGCUC… | 2143 nt | 0.5203 | |
| AGGCACUCCCUGGGCUAAACAGCAUCACCAUGUCUGUUCGAUACAGCUC… | 2163 nt | 0.5206 |
This gene encodes a member of the type I (acidic) cytokeratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. Mutations in this gene are associated with epidermolytic hyperkeratosis. This gene is located within a cluster of keratin family members on chromosome 17q21. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that a novel RNA suspension-fluorescent in situ hybridization (RNA S-FISH) method using a locked nucleic acid (LNA) probe for the KRT10 mRNA successfully labeled fresh and aged (10-month-old) buccal and vaginal epithelial cells, with the probe showing specificity by not hybridizing to leucocytes. This method enabled the isolation of labeled cells via laser microdissection, and full DNA profiles were obtained from 150 fresh cells, while aged cells yielded full profiles in 50% of samples and partial profiles with a minimum of 87.5% of alleles present [Williams et al. DOI:10.1016/j.fsigen.2013.11.007]. A separate spatiotemporal single-cell analysis in humans identified the KRT10 as a keratin marker highly expressed in keratinocyte clusters during skin wound healing [Liu et al. DOI:10.1016/j.stem.2024.11.013]. A study in human subjects demonstrated that the KRT10 protein, detected via immunocytology, is positive in epidermal cells and negative in buccal cells, allowing for the discrimination of epidermal versus mucosal cell origin in forensic swabs [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X]. The immunocytological technique successfully classified cell origin with 85-95% efficacy on postcoital and samples stored for up to one year, and q-RT-PCR analysis of KRT10 mRNA confirmed high relative expression in epidermal samples compared to mucosal ones.