Basic Information
MANE select
Secondary Structure
Secondary structure that contributes a minimum of free energy.
Thermodynamic properties of the Boltzmann ensemble.
Structure Prediction
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGUCCUCGGCCCAGGCCAAGCAAGCUUCUAUCUGCACCUGCUCUCAA… | 1688 nt | 0.5835 | |
| ACAGUCCUCGGCCCAGGCCAAGCAAGCUUCUAUCUGCACCUGCUCUCAA… | 1714 nt | 0.5823 |
Summary
The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Mutations in this gene and keratin 4 have been associated with the autosomal dominant disorder White Sponge Nevus. The type I cytokeratins are clustered in a region of chromosome 17q21.2. Alternative splicing of this gene results in multiple transcript variants; however, not all variants have been described. [provided by RefSeq, Jul 2008]
Forensic Context
A study in humans identified KRT13 as a major structural protein of oral mucosa and a stable mRNA marker for saliva identification, showing vast overexpression in saliva compared to semen and tissue-specific expression in stains aged up to 180 days [Zubakov et al. DOI:10.1007/s00414-007-0182-6]. In a separate study on the Chinese Han population, the KRT13 was included in a multiplex mRNA profiling system for body fluid identification, where it was observed in vaginal secretions, menstrual blood, and skin samples as noted in the introduction and discussion of that work [Song et al. DOI:10.1016/j.jflm.2015.08.006]. A study in human samples demonstrated that the KRT13 was only minimally or not at all useful for the specific forensic questions of discriminating between skin and mucosal cell origins in sexual assault investigations, as it was characterized as a general epithelial marker without discriminatory power for this application [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X].