| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCCGAGCACCUUCUCUUCACUCAGCCAACUGCUCGCUCGCUCACCUCC… | 1636 nt | 0.6082 |
This gene encodes a member of the keratin family, the most diverse group of intermediate filaments. This gene product, a type I keratin, is usually found as a heterotetramer with two keratin 5 molecules, a type II keratin. Together they form the cytoskeleton of epithelial cells. Mutations in the genes for these keratins are associated with epidermolysis bullosa simplex. At least one pseudogene has been identified at 17p12-p11. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that dermal wounding triggers the expression of the KRT14 in the hyperproliferative epithelium of healing tissue [Roy et al. DOI:10.016/j.ymthe.2005.07.684]. A study in human samples demonstrated that the KRT14 was tested as part of a panel of 19 cytokeratins for discriminating epithelial cell origins in forensic swabs, but it was found to be only minimally or not at all useful for the specific sexual-assault questions under investigation [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X].