Basic Information

Symbol
KRT14
RNA class
mRNA
Alias
Keratin 14 Keratin, Type I Cytoskeletal 14 Keratin 14, Type I EBS3 EBS4 K14 Keratin 14 (Epidermolysis Bullosa Simplex, Dowling-Meara, Koebner) Epidermolysis Bullosa Simplex, Dowling-Meara, Koebner Cytokeratin 14 Cytokeratin-14 Keratin-14 EBS1A EBS1B EBS1C EBS1D CK-14 CK14 EBS1 NFJ
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Wound age identification

MANE select

Transcript ID
NM_000526.5
Sequence length
1636.0 nt
GC content
0.6082

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-653.80 kcal/mol
Thermodynamic ensemble
Free energy: -682.23 kcal/mol
Frequency: 0.0000
Diversity: 438.39
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........(((((((((.((((((...(((((..(((.(((((..(((.((...((.((((.((((((.((((((((((.((((((.((((((((.(((...(((((.(((.((((....(((((((....(((((((((....)))))..)))).))))))).)))).)))))))).....((((((.........))))))((((...(((((..((((((((((((((((...))))))))((((..((((.(((((.(((.....))).)))))..)))).))))(((.((((........))))))).))))))))..))))).)))).))).)))))...))).)))))....).)))))))..))).)))))).))))))....)).)))..))))).(((((..(((...........)))..)))))((((((((.((.(((((.......)).)))))))))))))...((((..(((((........)))).)..))))....)))..)))))...))))))......(((....))).((.(((((...((((((.((...((((((......))))))...)).)))))).....((((...(((((((.(((.((..((((...((((((((((..((((.(((((((((....((((.(.(((........)))).)))).)))))))))....))))..)))))....((((((.(.(......).))))))).((((.......)))))))))...))))..)).))).)))))))..)))).....))))).))......))))))))).(((.((((..(.((((...(((((((((((..(((..(((((((..((((.((((.(.(((.(((((((((..((((((.((.....))))))).)..)))...(((((..(((....(((((((((((....)))........)))))))).........((((((..(((((((..(.((........)).)..)).)))((((.(((((...((.(.((((((...((((((((....(((((.((..((((.(((((.....))))))))).)).)))))....(((((((((((..(((((((.((..((((...))))....)).)).)..))))..)....)))))).))))...(.((((.((......)))))).)(((((((.(((((........))))).))...((((........))))))))).((((....))))))))))))..)))))).)...))...))))))))).((.(((((....))))).))))..))))))))).)))))((((((((.......)))))))).....(((.(((...((((.......(((((((......))).)))).....)))).))).)))))))))))).).))))))))(((.......)))..(.((((....)))).)(((..(((...((((((..((.(((.(((......)))))).))..)....)))))...)))..))).)))))))....)))....))))))))..))).))))).)))).)))...((((((........)))))).....
Thermodynamic Ensemble Prediction
..(((((.,.(((((((((.(((.((,..{{(((((((,((,((((.(((..{{{.((((((.{.(({,,.,,.{((((((..,..((((((((((,.(((({.(((((.(((.((((..{,(((((((....(((((((((....))))).,)))}.)))))))})))).))))))))(((((.((((((((.((...{((((,((.....,,}}}.,..}},}}|((((((((...)))))))),,}.)))))))))))))))}}}}}.|((.((({(((.(((.((....)).))))))).))).))}}))))))))),..)))))))})}}.)))))).}}...))).)))))}.((((((((.(((((((.((((((.(((((.(((((((((.((.(.....).)).)))).))))).))),}).))))))(((((((((.((.((((,.......)},)},)))))))))))..,{{..,{{|,..(((((((.((((..((((((((((..((((((({,((.(((((((.....((.((({{(.....((({.....})))))},,))}),.....}}}))))))))))....{((......))}..((((.(((.((.(((((((.{((((((((((((,(((,...(((((((((,...{{((.(.(((.,,....})))).)))).)))))))))}},.},||...{{{{{{,,((((((.{.{......).})))))},||||.}||..,(({......}}}..,.,,..|{{..||||))..)),}|||.{{{...,......,...}))|||.........,})}....)))))))))))),....))))))).)).))).)))))))))..)))).((((..((..{((({,((((.,,,..},|}}}.,..,,)}.}.}}}}..))))..,,..,..)))).....)))).))..)))).))))))).....))).}}.)},....,))))))).)))))))}.))))))),))))),))).)).,)))).))).,)))))..((((((.((..(((((.((..((((.(((((.....))))))))).)).)))))...))...|)|))))....(((.(((((.((((...))))((....,}..}}.(((|,{{..,{({...,.,,}}|}|)})})){,((.(((((((..((.((((((,.(((((........))))).}..{(((,({.......,,)),}))}..((((((..(((((.((((.(((.(((((((.((((..((({{,,((,((((((.((((,......}}}}}}}))}...{((((({.((((((((.......))))))))..({(((((.,,,..{{.{,,....,,||,,,.,}}}},)}}||,|||.,|.|}),.,|||||,,,))}))},}}})})}))}}.........}))}}}|.((((....))))..}}.,.))).)))).)))..{(.(((.(((......)))))).))..)))).))))))).)))...)).))))))}))))).)))))))}}.,)}.,....))))).)))........(((({{{,.....})))))).....

Transcripts

ID Sequence Length GC content
ACCCGAGCACCUUCUCUUCACUCAGCCAACUGCUCGCUCGCUCACCUCC… 1636 nt 0.6082
Summary

This gene encodes a member of the keratin family, the most diverse group of intermediate filaments. This gene product, a type I keratin, is usually found as a heterotetramer with two keratin 5 molecules, a type II keratin. Together they form the cytoskeleton of epithelial cells. Mutations in the genes for these keratins are associated with epidermolysis bullosa simplex. At least one pseudogene has been identified at 17p12-p11. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that dermal wounding triggers the expression of the KRT14 in the hyperproliferative epithelium of healing tissue [Roy et al. DOI:10.016/j.ymthe.2005.07.684]. A study in human samples demonstrated that the KRT14 was tested as part of a panel of 19 cytokeratins for discriminating epithelial cell origins in forensic swabs, but it was found to be only minimally or not at all useful for the specific sexual-assault questions under investigation [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X].