Basic Information

Symbol
KRT15
RNA class
mRNA
Alias
Keratin 15 K15 CK15 K1CO Keratin, Type I Cytoskeletal 15 Type I Cytoskeletal 15 Keratin 15, Type I Keratin-15, Basic Keratin-15, Beta Cytokeratin 15 CK-15 Cytokeratin-15 Keratin-15 KRTB
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_002275.4
Sequence length
1712.0 nt
GC content
0.5643

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-678.20 kcal/mol
Thermodynamic ensemble
Free energy: -709.85 kcal/mol
Frequency: 0.0000
Diversity: 405.26
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((.((.((((.((.(((((..(((((((((((.((.((.(((..((..(((((((.((((..((.(((((((((...(((((.(((((.(((..(((((.(((((..((((..((((((.((((((......)))))).))))))..))))..)))))))))))))))))).)))))..(((((......)))))...........((((((((((((((((.((((..(...((((.((((((((((..((((..(((((((((.(((((((((.((((((.(((..(((..(((((....)))))((((((.(((((((((((((((((.((((.(((.((.((((((((....((((.......))))..))))))))))...))))))).).)))))(((((((((.((.((.((.......)).)).)))))))))))......(((((((........)))).....))))))).....))))))).)))))))))))).)).)))))))))....))))...)))).....)))))...))))....)))).)))))).))))...)..)))).)....))))))))))..))))).(((((.((((((((((((..(((((..((((....)))).....(((((((((....((((.(.((((..(((.((((..((((....))))((((((((.(.((......)).)))))))))........))))))).)))).).))))....))).))))))((.(((.................))))).)))))..)))).)))))))))))))((.(((..((......))..))).))(((((((((((.........))))).))))))))))))))).)).....)).)).))))).(((((.......)))))))...)).))).)))))))).)))))))..)))))))))))..))..))))).))).........................((((((.(((((..(((((((((....((((((((((((((((...((((..((((((((.((((((((((......))))))))))..........((((........).)))((........)).)))))))).))))....))))).....((((((((.((((((((((.((((((((((........)))).)))).....((((((((.....)))).))))........)).))))))).)).((((((.(((.((((((((.((((.((.((((...(((...((..((((((.......))))))..))...))))))))).)))).))))))..)).))).)))))).............(((((..(.((((((.((((..((((((.((..(((.(((.(........).))).)))..))))))))....))))))).)))).)))))).)))))))).((((.(((..(((.((((((...((.(((((((.....((.(((((.....(((((.((((...((...))))))))))).....)))))))))))))).))........)))))))))..)))))))((((((......))))))......))))))))))).((((......)))).))).))))))....(((((.....))))).))))))))))).....
Thermodynamic Ensemble Prediction
,,((((((((.{{.((((.((,(((((,{(((((((((((.,,,((,(((,.{(..(((((((.((((,.((.(((((((((...(((((.(((((.(((..{((((.(((((..((((..((((((.((((((......)))))).))))))..))))..)))))})))))))))))).)))))..{{{{{.,,,.,||}}}..,.}}},|||{(((((((((((((((.((((..(...((((.((((((((((..(((({.(((((((((,((({((((,{((((((.(((.,{{{..(((((....)))))((((((.(((((({,(((((({({.((((.(((.((.((((((((....((((.......))))..))))))))))...))))))}.},)))))(((((((((.((.((.({.......)).)).)))))))))))..{((.,,(((({.,,.....,})}...,}}}},)))).},}})))))).))))))))}))).)).}))))))))....))))...})))....,))))}.},))))....))))}}))))).))))...}..)))).,}...})))))))))..))))}.((({{(((((((((((((..(((((..((((....}}}}..,,,(((((((((,{{.((((.(,((((..{{{.{{||,,||{|,,,,))}}((((((((.(.((......)).)))))))))...,,,..}}}}))).))}),),))}}....))).))))))||.(((............,....))),,.)))))..)))).))))))))))))){{.{{{,,||......))..))}.}}(((((((((((.........))))).))))))))))))))).)),.,..)).)).))))}.(((((.......)))))))}..}}.)}),))))))))||))))))..)))))))))))..},..)))))}})),,............,..,,......((((((.(((({..(((((((((....((((((((((((((((.,.((((..((((((((,((((((((((......)))))))))).}.......{((({........).}}}|{...||...)),)))))))).))))....))))).....((((((({.|(((((((((.|(((((((({.,......))))}}))),....{(({((((.....}))).))}}........,,.))))))).)).((((((.(((.((((((((.((((.((.((((,..{((...((..((((((.......))))))..))...))))))))).)))).))))))..)).))).)))))),,.....,},.,,{((({..(,((((((,((((.,(((((((((..({{.{{(.|........).))).)))..)))))))}..,}))})))).)}}},)))))).}))))))}.((((.(((..(({,((((((...((.(((((((.....((.(((((.....(((({.((({...{{...}}))))))))).....)))))))))))))).))........)))))))))..))))))){(((((,{...,))))))......))))))))))).{{{{|....})))).))).))))))....(((((.....))))).})))))))))).....

Transcripts

ID Sequence Length GC content
CUGGUACCUCCUGCCAGCAUCUCUUGGGUUUGCUGAGAACUCACGGGCU… 1712 nt 0.5643
Summary

The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains and are clustered in a region on chromosome 17q21.2. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans and rats demonstrated that the KRT15 is a spatially variable gene expressed in the urethra of rat penile sections [Yin et al. DOI:10.1016/j.celrep.2024.114760]. In human skin wound healing, the KRT15 was identified as a keratin marker expressed in the basal keratinocyte cluster in spatial transcriptomic sequencing [Liu et al. DOI:10.1016/j.stem.2024.11.013]. A study in humans demonstrated that a panel of 19 cytokeratins, including the KRT15, was tested for discriminating epithelial cell origins on forensic swabs from sexual offense investigations [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X]. The experimental findings indicated that the KRT15 was only minimally or not at all useful for the specific forensic questions under investigation regarding sexual assault, as it served as a general epithelial marker without providing discriminatory power for distinguishing between skin and mucosal cell origins.