| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUGGUACCUCCUGCCAGCAUCUCUUGGGUUUGCUGAGAACUCACGGGCU… | 1712 nt | 0.5643 |
The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains and are clustered in a region on chromosome 17q21.2. [provided by RefSeq, Jul 2008]
A study in humans and rats demonstrated that the KRT15 is a spatially variable gene expressed in the urethra of rat penile sections [Yin et al. DOI:10.1016/j.celrep.2024.114760]. In human skin wound healing, the KRT15 was identified as a keratin marker expressed in the basal keratinocyte cluster in spatial transcriptomic sequencing [Liu et al. DOI:10.1016/j.stem.2024.11.013]. A study in humans demonstrated that a panel of 19 cytokeratins, including the KRT15, was tested for discriminating epithelial cell origins on forensic swabs from sexual offense investigations [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X]. The experimental findings indicated that the KRT15 was only minimally or not at all useful for the specific forensic questions under investigation regarding sexual assault, as it served as a general epithelial marker without providing discriminatory power for distinguishing between skin and mucosal cell origins.