| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGCACGCUCUCAGCCUUCCUGAGCACCUUUCCUUCUUUCAGCCAACU… | 1658 nt | 0.6098 |
The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains and are clustered in a region of chromosome 17q12-q21. This keratin has been coexpressed with keratin 14 in a number of epithelial tissues, including esophagus, tongue, and hair follicles. Mutations in this gene are associated with type 1 pachyonychia congenita, non-epidermolytic palmoplantar keratoderma and unilateral palmoplantar verrucous nevus. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the KRT16 was detected in tongue tissue using the Oxford Nanopore MinION direct RNA sequencing kit, supporting its utility as an mRNA marker for tissue identification [Dunn & Fleming DOI:10.1080/00450618.2019.1571105]. In a separate investigation of UVB-induced inflammatory pain, the KRT16 was found to be up-regulated in both human and rat skin, with a fold change of 26.2 in humans and 9.6 in rats, indicating its role in cell stress and wound healing responses [Dawes et al. DOI:10.1371/journal.pone.0093338]. A study in human samples demonstrated that the KRT16 was tested as a general epithelial marker but was found to be only minimally or not at all useful for the specific forensic questions of discriminating between skin and mucosal cell origins in sexual assault investigations [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X].