| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACAACUUGGGGCCCCUCUCCUCUCCAGCCCUUCUCCUGUGUGCCUGC… | 1517 nt | 0.6190 |
This gene encodes the type I intermediate filament chain keratin 17, expressed in nail bed, hair follicle, sebaceous glands, and other epidermal appendages. Mutations in this gene lead to Jackson-Lawler type pachyonychia congenita and steatocystoma multiplex. [provided by RefSeq, Aug 2008]
A study in mice and humans demonstrated that the KRT17 is significantly up-regulated in UVB-irradiated skin at the peak of hyperalgesia, with a fold change of 17.9 in human and 19.2 in rat skin [Dawes et al. DOI:10.1371/journal.pone.0093338]. In a separate investigation of human skin wound healing, the KRT17 was identified as a marker expressed in wound-edge keratinocytes via spatial transcriptomics, contributing to the cellular architecture of the healing margin [Liu et al. DOI:10.1016/j.stem.2024.11.013].