| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCGCCACCGUCGUCCGCAAAGCCUGAGUCCUGUCCUUUCUCUCUCCCC… | 1413 nt | 0.5824 | |
| AUUUCCUGCCCUGAAAGCAGCCUCGAGGGCCAACAACACCUGCUGUCCG… | 1442 nt | 0.5825 |
KRT18 encodes the type I intermediate filament chain keratin 18. Keratin 18, together with its filament partner keratin 8, are perhaps the most commonly found members of the intermediate filament gene family. They are expressed in single layer epithelial tissues of the body. Mutations in this gene have been linked to cryptogenic cirrhosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] CIViC Summary for KRT18 Gene
A study in mice demonstrated that the KRT18 is a potential pain mediator, as it was the most up-regulated gene in human UVB-irradiated skin with a fold change of 196.3 and was also significantly up-regulated in rat skin with a fold change of 51.4, showing a strong positive correlation in gene expression between species [Dawes et al. DOI:10.1371/journal.pone.0093338]. A study in human samples demonstrated that the KRT18 is expressed by both menstrual blood-derived and endometrium-derived endometrial cells, serving as an epithelial cell marker [Zhao et al. DOI:10.3892/etm.2021.10856]. In forensic contexts, immunocytological analysis of cytokeratin expression patterns, including the KRT18, can discriminate epithelial cell origins on swabs, with techniques successfully classifying mucosal or epidermal origin in 85-95% of cytological samples and remaining effective on postcoital and samples stored for up to one year [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X].