Basic Information

Symbol
KRT18
RNA class
mRNA
Alias
Keratin 18 Cell Proliferation-Inducing Gene 46 Protein Keratin, Type I Cytoskeletal 18 Keratin 18, Type I CK-18 CYK18 K18 Cytokeratin 18 Cytokeratin-18 Keratin-18
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_000224.3
Sequence length
1413.0 nt
GC content
0.5824

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-561.80 kcal/mol
Thermodynamic ensemble
Free energy: -582.58 kcal/mol
Frequency: 0.0000
Diversity: 333.22
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.((((.(((((((((((((.(((((((((((((((((((((((((((((..((.(.((((((....(((((((((.((((((.........((((...))))((((((((((((((((.......))))(((((..(((((((((.((..(((((((((....)))))))))..)).)))(((((((((((.(((((..(((((((..........))))))))))))))))))))))))))))).)))))...((((((((((...((((..((.(.((..(((..........)))..)).).))...))))...)))).))))))......))))))))))))))))))..)))))..)))).....)))))).)...))....)))))).).....)))).)))))))))..((((((.((((((((((......)))).)).)).))...)))))))))))))))..))).........)))))))...(((((.(((...((((((.(((.....(((.((((((.((((..(((((....))))))))))))))).).))(((((.((((..((((((((((........)))))))))).)))).))))).(((((.......)))))..)))))))))(((....))).))))).)))((((...)))).(((.((((((.((.........)).))))))..)))............((((((((........))))))))))).)))).)))...((((((((((.(((.(((..((((((......)))).))..)))))).(((.(((....((((..(((((.....)))))...))))......))).))).((((((((((((.((.((.(((....))).)).))...))))))))))))((((.(((((((....(((..(((..((.((((.(((.....))))))).))..))).)))..(((..(((((.(......(((.....)))).)))))..))).(((((((.(((((....)))))...)))).)))....)))))))))))((((((((((((.(((((((.....(((.(((.((.((((((((....((......))..)))).)).)).))..)))..))).....))))))))).(((((((((....((((((((((..(((((.((......)).))))))))..........))))))))))))...)))).(((......)))...(((((((.....((..........))....))))))).....(((((((..........)))))))...(((((.(((.....)))..)))))))))))).)))))))))).))).....(((((................))))).
Thermodynamic Ensemble Prediction
(((.((((.((((((((({(((.(((((((((((((((((((((((((((((..((.{.((((((....(((((((((.((((((,........((((,..|}}}((((((((((((((((.......))))(((((,,(((({{{{|.{|,.(((((((((....))))))))).,||,}}|((((((((({(,(((((..(((((((..........))))))))))))))))))))))))})))).)))))...((((((((((...((((..{(.(.((..(((..........)))..)).).)}...))))...)))).))))))......))))))))))))})))))..)))))..))))....,)))))).).,.))....)))))).}.....))))}}))))))))..((((((.((((((((((......))))},).)).))...)))))))))))))))..))}.||......|||||}}...{,|||}|{,,,{((((((.{{(.....{({.((((((.((((..(((((....)))))))))}))))).|,||(((((.((((..((((((((((........)))))))))).)))).)|||}.{({({.......,}))}..,))))}}}}(({.,..}}}.|,}}|.||{(({{...,.}}}|||.((((((.((.........)).))))))...||....{{|.,...{|||{{{{..,,,,,,))))))))))).)))).)))...((((((((({,{{{.({,.,({((((......)))).},..|||{{{{(,..,......|,,,})|||||}....}}}}),,,.{||{{.....,.})))}((((((((((((.((.((.(((....))).)).))...))))))))))))((({{(((((((,.{.{,{..(((.,{{.((((.({(.....))))))),}}|||||.||}..{{{},|||||.|,,....|||..,,,}}}}})}}}}..}}}.(((((((.(((((....)))))...)))).)))....)))))))))))(((((((((((,.((((((({{{{{{({.(((.((.((((((((...{({......))..)))).)).)).))..)))..,))},.}.))))))),..(((({.{(({{{{{((((((.((.((((,....},.)).)).)))))),,.......}}}}|||((((((((((({.{{,{{{......)))...(((((((.....((..........))....))))))).....(((((((..........)))))))..}})))))))))))..,))))),}.)))))))).)))))))))).))}.....(((({.............,,.})))).

Transcripts

ID Sequence Length GC content
GCCGCCACCGUCGUCCGCAAAGCCUGAGUCCUGUCCUUUCUCUCUCCCC… 1413 nt 0.5824
AUUUCCUGCCCUGAAAGCAGCCUCGAGGGCCAACAACACCUGCUGUCCG… 1442 nt 0.5825
Summary

KRT18 encodes the type I intermediate filament chain keratin 18. Keratin 18, together with its filament partner keratin 8, are perhaps the most commonly found members of the intermediate filament gene family. They are expressed in single layer epithelial tissues of the body. Mutations in this gene have been linked to cryptogenic cirrhosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] CIViC Summary for KRT18 Gene

Forensic Context

A study in mice demonstrated that the KRT18 is a potential pain mediator, as it was the most up-regulated gene in human UVB-irradiated skin with a fold change of 196.3 and was also significantly up-regulated in rat skin with a fold change of 51.4, showing a strong positive correlation in gene expression between species [Dawes et al. DOI:10.1371/journal.pone.0093338]. A study in human samples demonstrated that the KRT18 is expressed by both menstrual blood-derived and endometrium-derived endometrial cells, serving as an epithelial cell marker [Zhao et al. DOI:10.3892/etm.2021.10856]. In forensic contexts, immunocytological analysis of cytokeratin expression patterns, including the KRT18, can discriminate epithelial cell origins on swabs, with techniques successfully classifying mucosal or epidermal origin in 85-95% of cytological samples and remaining effective on postcoital and samples stored for up to one year [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X].