| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUCCUCCCGCGAAUCGCAGCUUCUGAGACCAGGGUUGCUCCGUCCGUG… | 1390 nt | 0.6180 |
The protein encoded by this gene is a member of the keratin family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. Unlike its related family members, this smallest known acidic cytokeratin is not paired with a basic cytokeratin in epithelial cells. It is specifically expressed in the periderm, the transiently superficial layer that envelopes the developing epidermis. The type I cytokeratins are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the KRT19 transcript was mapped to an epithelial cell cluster within epicardial-derived cells (EDCs) using single-cell RNA sequencing [Yuan et al. DOI:10.1161/CIRCULATIONAHA.120.052928]. A study in human samples demonstrated that the KRT19 was tested as a general epithelial marker but was found to be only minimally or not at all useful for the specific forensic questions regarding sexual assault investigations under investigation [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X].