Basic Information

Symbol
KRT19
RNA class
mRNA
Alias
Keratin 19 K19 Keratin, Type I Cytoskeletal 19 CK19 K1CS 40-KDa Keratin Intermediate Filament Keratin, Type I, 40-Kd Keratin 19, Type I Cytokeratin 19 MGC15366 CK-19 Cytokeratin-19 Keratin-19
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_002276.5
Sequence length
1390.0 nt
GC content
0.6180

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-592.20 kcal/mol
Thermodynamic ensemble
Free energy: -611.69 kcal/mol
Frequency: 0.0000
Diversity: 306.44
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((..((((((...((((((.(((....)))))))))...(((((((..((((((((((((((((((.((..(((.((((..(((((((.(((.(((.(((...)))))).))).))))((((((.(((.((((((((((..((((((((((.((((((((.((((....(.((((...((.((.(((((.....))))).)).)))))).)...))))....((((.....(((((((...(((((((((....))(((((.......))))).((.(..(((((((..(((........)))..))).))))..).))..)).))))).))))))).....))))..)).))))))...))))))))))..))))..(((((..(((......)))..))))).))))))))))))))).((((((....(((.......(((((.((((((((((.((((((..(((((((((((...((((((.................)))))))))))))))))............((((((....))))))..(((((...((....))...)))))..((((((((((....))))))).)))........(((((((..(((((((((.....)))..))))))..)))).))).))))))(((....)))...(((((...((....((((((((.(((.(.(......).).))))))...)))))...))...)))))...(((....))))))).)))))).)))))....)))...)))).))(((((.....)))))......)))..)))))))...)).)))))))))).)))).....((((..((....((((......))))))..)))).((((((...((..(((..((((((.(((((...((((.(.((((.....)))).).)))).))))).)))))).)))..))..))))))((((((..((((..(((((..(((((((((.((.(.(((((((((((.(..................).)))))).))))).).)).)))))(((((........))))).((((((.((((....((((....))))...))))..)))))).)))))))))..))))..))).))).))))..)))))))......))))))..)))))((((((..(((..((((((((.(((.(.((((((((((((((.((.(((......((((.(((((((..((...))..)))))))))))...)))))))))..)))))))))))))).)))......))))).(((..((..(((.......)))..))))))))...))))))..(((((((.(((....)))))))...)))..
Thermodynamic Ensemble Prediction
(((((..((((((...((((({{(((....)))))))))...(((((((..((((((((((((((((((.{,..(((.((((..(((((((,{({.{{(.({{.,,||}}||,|||,|||}((((((.(((.((((((((((..((((((((((,((((((({.,,.,.,,.((((((.,.(((((.(((((,{...|||||.,|.||||||{|{.,|.|{((({(,,,....}||||||{,,.|||||||}..,||||||||,...,.})))},,,{{.({.(((((((..(((........)))..))).))))..)})}..,).))))).)))))))....,))},..)),)))))}...))))))))))..))))..(((((..(((......)))..))))).))))))))))))))).((({{{.|,,({,.......(((((.((((((({((.((((((..(((((((((((...((((((.,.,.....,}.}....)))))))))))))))))............((((((....))))))..{((((...({....})...))))}..((((((((((....)))))))}}))........(((((((..(((((((((.....)))..)))))),,)))).))).))))))(((....)))...(((((...({..,.((((((((.(((.(.{......}.).))))))...)))))...))...)))))...|{{..,,))})))).)))))).)))))...}))).}})))).))||{{{.,...,}}}}}}},.,)))..)))))))...,}.))))))))))},))),,{..((,{..||.|,|||...,({(({{|,,|,}}})).{{{{{{...|{..|||,,((((((.(((((...((((.(.((((.....)))).).)))).))))).)))))).)))..))..))))))((((((..((((..(((((..(((((((((.((.(.(((((((((((.(..................).)))))).))))).).)).)))))(((((........))))}.((((((.((((....((((....))))...))))..)))))).)))))))))..))))..))).))).))))..)))))))......))))))..)))))((((((..(((..((((((((.(((.{,(((((((((({{((,,,.((,,,....{(((.(((((((..((,..,}}}))))))))))}...))))}}}))}.)))))))))))))).))).....,))))).{((..(({,(((.......)))}.))))))))...))))))..(((((({,(({....}))))))...)))..

Transcripts

ID Sequence Length GC content
GCUCCUCCCGCGAAUCGCAGCUUCUGAGACCAGGGUUGCUCCGUCCGUG… 1390 nt 0.6180
Summary

The protein encoded by this gene is a member of the keratin family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. Unlike its related family members, this smallest known acidic cytokeratin is not paired with a basic cytokeratin in epithelial cells. It is specifically expressed in the periderm, the transiently superficial layer that envelopes the developing epidermis. The type I cytokeratins are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the KRT19 transcript was mapped to an epithelial cell cluster within epicardial-derived cells (EDCs) using single-cell RNA sequencing [Yuan et al. DOI:10.1161/CIRCULATIONAHA.120.052928]. A study in human samples demonstrated that the KRT19 was tested as a general epithelial marker but was found to be only minimally or not at all useful for the specific forensic questions regarding sexual assault investigations under investigation [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X].