Basic Information

Symbol
KRT2
RNA class
mRNA
Alias
Keratin 2 KRT2A KRTE Keratin, Type II Cytoskeletal 2 Epidermal Epithelial Keratin-2e Keratin-2 Epidermis Type-II Keratin Kb2 Keratin 2, Type II Cytokeratin-2e Keratin-2e CK-2e KRT2E K2e Keratin 2A (Epidermal Ichthyosis Bullosa Of Siemens) Epidermal Ichthyosis Bullosa Of Siemens
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Wound age identification

MANE select

Transcript ID
NM_000423.3
Sequence length
2450.0 nt
GC content
0.5363

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-925.20 kcal/mol
Thermodynamic ensemble
Free energy: -968.81 kcal/mol
Frequency: 0.0000
Diversity: 684.54
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((....((((.(((((.((((..(((((((((((((.(((((((((.....(((......)))......)))))).)))..))))))..........)))))))...)))))))))(((((((((.(((((.(((((((((.((((((.((((.((((((....)))))).))))...(((.(((((((((((((..((((((((....))))))))((((((((((((((.((..(((......(((.(((((((((((.((.((((((((((((((.(((((((.....(((.((((((...(.(((((((......))))))).)...)))))).)))..))))))).)))))).(((.......)))((((((((((.....(((((((((((((.(((...(((((((((((((((....)))))))))))(((..((((((((((((....)).)))(((((((((((((((.((((((((...((((.(.(.((((.((.....)).)))).).).))))..))).))))).)))))))).)))))))((((......)))).))))))).))).............((((((((.((((.((.......))))))..........(((..((((.......)))).)))))))))))((((((....((((((.......)))...)))..)))))).(((((......))))).)))).)))))))))..)))))))))))).)))))(((.(((((..(.((.((((((((..((((((((..((..........))..)))).)))).(((((((((.(((..(((((....(((((((......)))))))....))))).............(((((((((((...(.......)...))))).))))))....((((...(((..(((((.........)))))..)))...))))........((((......))))..))).)).)))))))...))))).))).)))..)))))))).(((((......)))))..((((......))))))).))))).)).)))))..........)))))).)))))).)).)))))))))))....)))....((.((......))))...)))).))).)))))))))((((((((((........)))).))).))).((((...(((((............))))))))).....((((........))))....)))))).))))....(((((((((.((....(((.....(((((.(((.((((..((((..(..(((...((((((..(((((..(((...((.(((((.....)))))((((.(((....(((.......))).....))).))))..(((((.((((((((((((.....)))))).(((((.(((.((....))))).)))))......(((.((.((((....(((......))))))).))..)))...)))))).)))))((((..(.(((.....))).)..)))).)).))).)))))..))))))...)))..).))))..)))).))).)))))...)))...)).)))))))))..((((((((((((((((.((((((((..((.((((((((..((((((((..........(.((((((((.(((......))))))))))).)((((((((((((((.(((.........(((((.(....((((((((((..(((((.(((((((((((.((((.(((...((((((((...))))..(((((((((((((..........))))))))))))).......(((.((((((((....(((((((((((.(.(((((((((..(((...((.(((((.(((((((((((....((((.((((((.((.(((.(((((.(....).)))..)).))).)).)))))))))).......)))))))))))......((...)).....))))))).)))..)))))))..)).).))))).))))))))))))))...))).(((((.......)))))(((((.(((((.(........).)))))...))))).))))...)))..))))....)))))).))))))))))....))))))))))....).))))).......(((((((....((.((((.(((((........))))).)).)).))...))))))).)))...))))))).)))))))...))))))))..)))))))).))..))).((((((......((((((...))))))..))))))....)))))(((((..(((((........)))))..)))))....)).)))))))))))))).))))).))))).))))))))).........))))..)))......
Thermodynamic Ensemble Prediction
.(((.{{.((((..,.{.,(((((,{{{{{{|||,|.||,||{{|,((((((({(({(,,..,{{{{,|.,|,..}})).((((((((.{,...,(((((.{..{(((((((.((((((..((((((,,{{(((((.((({,{(.{,....,)}),.))).))))}})))))}}))..)))))).)))))))).)))))((((((((....)))))))){{((((((((((((.((,.(((......(((.(((((((((((.((.((((((({((((((.(((((((.,...(((.((((((...(.(((((((......))))))).)...)))))).))),.))))))).)))))),(((.......)))|(((((((({....{(((((((((((((.(((...(((({{(((((((((....)))))))))}|(((,,((((((({((,({,,,,|,|||(((((((((((((((,(({{{(((,..{{||,,.,,|||{.||},.,,||.,})),).}.)))),.)}),))))).)))))))).))))))|((((......)))),}))})}}.}))},....,....||((((((((,((((.((.......)))))}.,........{((..((((.......)))).))})))))))){{((((,,..((((((.......)))...)))..}))))).(((((......))))).)))).)))))))))..))))))))))})}))))}(((.(((((..(.((.((((((((..((((((((..((..,....}..))..)))).)))).(((((((((.(((..(((((....(((((((......)))))))....)))))..,,,...,}}..(((((((((({...{.......)...))))).))))))...{((.({(.,,,.}|||||.........,}}||,.,,,{{{||||,...}))}|})))....})},,..))).))}}}))))}...))))).))).)))..)))))))).(((((......)))))..((((......))))}}),))))).)).)))))..........)))))).)))})).}).)))))))))))...,))).,..,))))))))),,}}))}))))}})))..}..,.(((((((((..(((((((((....((({{{,((((((({..{((((....,}}.,,,,),},}))))...},}.||........((((((((........))).)))))(((((...((((((((((.,,((((.(((......|||}|||....{{{||||...||||,}|||,..|||...,},||}}}|(((((((,(((((.{(.{(((((((....((.((((...((((((,{.,(((((.((((((((((((.....)))))).{(({{,{((.({....}}}}}.}})}}.,....({(.,(,(((({{{.,.,,{{{.....}))).)).|))}...)))))).)))))((((..(.({(...,||}}.}..|}}}.(({{{,.,{||,|||{(,({{{,,,,.}))))))|||}}}}},,..}}},}}.}}}....(((((((((((...})))))))))).((((({.,.(({..((.((((((((..((((((({.....,,...(.((((((({{(((......})))))))))).)((((((({(((((({(({,,,,}}}}|{((((,({.,,((({{{{((({,((({{.((({((((({(,((((,((({,,((((({{,..{{{||{{(((((((((((((..........))))))))))))}.....,..((((((((....)))))))),{|{(({{{.{{{|||||,,(,,...,,,||(((.(((((((((((....((((.((((((.((.(((.(((((.(....).)))..)).))).)).)))))))))).......))))))))))).}},..|,,}}}}}}...}|}||,}.}}}..|||||||,{}|{|{,||}}{{|,|||..,((({(({({{{...,,|.........{((((((.......))))))}.,,|{|||||.,|||,||,}}}}...)}}.,}}},....}))))),)))))))}}},},,)))))))})),.}}),)})))|||,,,,||||{|||,|.||.|||{.|||||,,,,,,,,)))}},)).)),}),,.)))))}}.,))}},))))))).)))))))...})))))))..)))))))).)),,)))})}.))))).))))))...)))).)).....))))))).}.)),))))}...})))))))).))),,,,..))))))))))...)))))}}))))....)))))))))...))))))))).........)))).})))......

Transcripts

ID Sequence Length GC content
AGCACAGUUGAGUCUCCAGCCUUGACUCUUCUCAAGAGCCUGUGACUUU… 2450 nt 0.5363
Summary

The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human skin wound healing using single-cell and spatial transcriptomics identified the KRT2 as a marker for suprabasal keratinocyte identification, where it was expressed in a suprabasal cell cluster in spatial transcriptomic analysis [Liu et al. DOI:10.1016/j.stem.2024.11.013]. A study in humans identified the KRT2 as a candidate mRNA marker for skin identification, ascertained from the GNF SymAtlas database [Visser et al. DOI:10.1007/s00414-010-0545-2].