| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACACACUCUGCCCCAACCAUCCUGAAGCUACAGGUGCUCCCUCCUGG… | 1804 nt | 0.4579 |
The protein encoded by this gene is a member of the keratin family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This cytokeratin is a major cellular protein of mature enterocytes and goblet cells and is specifically expressed in the gastric and intestinal mucosa. The type I cytokeratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2008]
A study in human keratinocytes demonstrated that X-ray irradiation (5 Gy) induced significant gene expression changes, with the KRT20 being the most strongly upregulated (3.31-fold) and its induction confirmed via RT-PCR and western blot [Koike et al. DOI:10.1269/jrr.46.173]. In human and mouse skin wound healing research, a comprehensive single-cell atlas identified FOSL1 as a critical driver of keratinocyte migration, with validation showing that silencing FOSL1 reduced keratinocyte motility and that EGFR ligands enhanced its expression [Liu et al. DOI:10.1016/j.stem.2024.11.013]. A study in human samples demonstrated that a panel of 19 cytokeratins, including the KRT20, was tested for discriminating epithelial cell origins in forensic swabs, but the KRT20 was found to be only minimally or not at all useful for the specific sexual-assault questions under investigation [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X].