Basic Information

Symbol
KRT4
RNA class
mRNA
Alias
Keratin 4 CYK4 K4 Keratin, Type II Cytoskeletal 4 CK4 Type-II Keratin Kb4 Cytokeratin 4 CK-4 Keratin 4, Type II Cytokeratin-4 Keratin-4 WSN1
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Postmortem interval inference

MANE select

Transcript ID
NM_002272.4
Sequence length
2141.0 nt
GC content
0.5525

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-791.80 kcal/mol
Thermodynamic ensemble
Free energy: -828.99 kcal/mol
Frequency: 0.0000
Diversity: 493.34
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((.(((((((((..(((((....((((.((((((..((((((.(((.(..((....(((((......)))))))..).)))))))))...))))))))))..)))))..))))....)))))(((((.(((((.((((.((((((....(((.((((((((((((.((((((((..((((((((((((.((((((((.......))).(((((..((((.(((((.........))))).)))))))))(((((.(((((((.((.(.((((...(((((((..(.(((((((((...(((((((((((((((.(((..(.((((((((((........)))).)))))).)..))))))))..((((....)))).......))))))))))....))))))))).).)))))))((((....)))).......(((.....)))...(((..((.(((.(((.((((((......................))))))))).))).)))))..((.((((((((....(((...........((.((((((((....((((..((.((..(((..((((..(((((.((((((((.......((((.(.((((((((((.(((.((.(..(((((((.((...(((((((((..(..(.((..(.....)..)).)..)..)))).)))))....))...)))))))..).))))).))).............))))))).).))))....((((.((((........)).)).))))(((((.....)))))((((...))))((((((.....)))))).))))))))....)))))...))))...)).)..)).))..))))....))).))))).))))))))))))).))....)))).))).)))).(((....((((((((......))))))))......))).....((((((.(...(((....)))).)))))))))))))).......))))).)))))))))))).((((........))))(((...))).....)).)))))).)))))).....((....)).)))))).)))...))))))..))))..((((((..((((((.(((.....(((...))).(((((((((((..((((...((...(((((((((.(((((((((((((...(((((((.(.((((........)))).).).))...)))).........(((((.(((..((...(((((((((((.(.(((((((..(((((((((..(((((((...(.(((.((.(((((((.((((..(((...(.((((...(((((((..(((((((....(((((..(((..(((...))))))..)))))........).))))))(((((.(((((........)).))))))))..)))))))....)))))))).))))..)).))).)).)).))).)....)))))))...))))))))).)))).)))...).)))))))))))...)).))).)))))..((.(((((.((((((....(((((((((..((((((((((...........((.....))(((.(((((((((...(((((.......((((((((....))).)))))..(((((.((....)).)))))...........)))))..))))))))))))((((.....((....))...)))).............((((.......))))..))))))))))...))))))))))))))).))))).)).))))))))))).)).)))))))))((((..((((((.......((((.((((((((((((..(.(((((((..........(((.((..........)).)))((((......)))).........))))))))..)))).)))))))).))))((((.((((......))))...))))..........))))))..)))).))...)))).....))).))))).)))))).))))))...(((((((.((..(((...))))).)))))))......)))))).)))))..)))))....)))))...........(((((....).))))..
Thermodynamic Ensemble Prediction
...((((,{((((((((..(((((....((((.((((((..((((((.(((.(,,{,,,,.{((((......)))))})),}.)))))))))...))))))))))..)))))..))))....))))))))|(((((((.((((.((((((....(((.((((((((((((.((((((((..((((((((((((.((((((((,{{,...}}}{{(((...(((({(({,{........,|||||,||}},|}|(({(((.((({,{{.{|}|,||||}..(((((((..(.(((((((((...(((((((((({{(((.(((..(.((((((((((........)))).)))))).)..)))))),||.((((....))))....,,.))))))))))....))))))))).).))))))){{{{.,,,)))),,,..}}|||}}...||},,,{||,,{,,{({.({(,((({,,...,....,|{,{{..,..,.,||||||}||{|||,|||.{,{(({(((({((({{{{(,,......,{{(((,{(((((.,,...,((...(((((.....})))}....|||,,.,||||||,....}}}|||,.,.,,{|||||||,,{{.(({({,{{{{|||}||..,|||||,{,{.|{||{,{{..{.....},,||,||{|{,||||..}}}}.,,,)}.}})))),},,})}))))),}}},.,,,,,..,,.,)},)))),).)),,....|||.|{{{{.|||.....},))}),))(((((.....)))))}}}},)))))}|(((((.....)))))}.}}||||||{{.{||,||...((({{...,..}}))}...}),))}...)),)))))),||||}||,}||||.,,....)))).})).)))),(((....((((((((......))))))))......))).....((((((.(.,.({{....)))).))))))||||}},)),,..,,))))).)))))))))))).((((..,,,...}))){{{...}}}.....)).)))))).)))))),....((....}}.,))))).)))...))))))..)))),,(({,{,..{((((({(({...,{((,....||{({{((((((((..({({..,((,..{((((((((.(((((((((((((...(((((((.(.((((.,......)))).},).},..,)))).........(((((.(((..((...(((((((((((.(.(((((((..(((((((((..(((((((...{.{((.((.(((((((.((((..(({..{(.((((...(((((((,,(((((((....(((((..(({,,(({...})),)).,)))))........),})))))|{{{..,{|(({,,,{{..}}.)))}))))}.)))))))....)))))))).))))..)).))},)).)).))}.}....)))))))...))))))))).)))).)))...).)))))))))))...)).))).)))))..((.(((((.((((((,...{((((((((..((((((((({,..........,|.....||(((.(((((((((...(((((....,..((((((((....))).)))))..(((((.({.....).)))))...........)))))..))))))))))))((((.....{{....})...)))).............((((.......)))).,)))))))))}...))))))))))))))).))))).)}.))))))))))).)).))))))))}((((..((((((.......{(((.((((((((((((..{.((((((({{.{(,,....))...)}},.....,{{{{{.{{{|.,,,,,}}||,,.....,})))))))}..))))})))))))).)))|((((.((((......))))...))))..........))))))..)))).,,...)))).....))),})))).})))),,)))}})},,|{((((({((.......,|||,,.)))}}}}....}})}}}}},}}}},..,}.}},},})}}},.},,,..........)))))))},....

Transcripts

ID Sequence Length GC content
ACUCACCGGCCUGGGCCCUGUCACUUCUCUGAUAGCUCCCAGCUCGCUC… 2141 nt 0.5525
Summary

The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in differentiated layers of the mucosal and esophageal epithelia with family member KRT13. Mutations in these genes have been associated with White Sponge Nevus, characterized by oral, esophageal, and anal leukoplakia. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the KRT4 as a stable mRNA marker for saliva identification, showing vast overexpression in saliva compared to semen and tissue-specific expression in stains aged up to 180 days [Zubakov et al. DOI:10.1007/s00414-007-0182-6]. Subsequent research confirmed the KRT4 demonstrates stability in saliva stains for up to 6 months under controlled conditions, aiding in post-mortem interval estimation through degradation pattern analysis [Kumar et al. DOI:10.1016/J.Jflm.2025.103044]. A study in humans demonstrated that the KRT4 protein, detected via immunocytology, is a positive marker for mucosal cells (buccal and vaginal) and negative in epidermal cells, enabling the discrimination of mucosal versus skin cell origin on forensic swabs [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X]. This immunocytological technique successfully classified cell origin with 85-95% efficacy on postcoital samples and samples stored for up to one year, and complementary mRNA analysis of KRT4 confirmed high relative expression in mucosal samples.