| ID | Sequence | Length | GC content |
|---|---|---|---|
| AACAGAGCCACCUUCUGCGUCCUGCUGAGCUCUGUUCUCUCCAGCACCU… | 2238 nt | 0.5688 |
The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the basal layer of the epidermis with family member KRT14. Mutations in these genes have been associated with a complex of diseases termed epidermolysis bullosa simplex. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
A study in human skin wound healing demonstrated that the KRT5 is a highly expressed keratin marker used for keratinocyte identification in single-cell and spatial transcriptomic analyses of acute and chronic wound-edge tissues [Liu et al. DOI:10.1016/j.stem.2024.11.013]. A study in humans demonstrated that the KRT5 is a cytoskeletal protein used for wound age estimation, where the absence of positive keratinocytes indicates a wound age of less than 19 days [Cecchi DOI:10.1007/S00414-010-0505-X].