Basic Information

Symbol
KRT5
RNA class
mRNA
Alias
Keratin 5 CK-5 KRT5A Keratin 5 (Epidermolysis Bullosa Simplex, Dowling-Meara/Kobner/Weber-Cockayne Types) Epidermolysis Bullosa Simplex 2 Dowling-Meara/Kobner/Weber-Cockayne Types Keratin, Type II Cytoskeletal 5 Type-II Keratin Kb5 Keratin 5, Type II Cytokeratin-5 EBS2 K5 58 Kda Cytokeratin 58 KDa Cytokeratin Keratin-5 EBS2A EBS2B EBS2C EBS2D EBS2E EBS2F DDD1 EBS1 CK5 DDD
Location (GRCh38)
Forensic tag(s)
Wound age identification Tissue/body fluid identification

MANE select

Transcript ID
NM_000424.4
Sequence length
2238.0 nt
GC content
0.5688

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-874.30 kcal/mol
Thermodynamic ensemble
Free energy: -911.23 kcal/mol
Frequency: 0.0000
Diversity: 622.04
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((.....((.((.....)).))))))))))..((((((((((..(((..((((((((((.(((((((((((((((.(((((....(((((((...(((((((.(.((((..((.(((((((((((((((((.((.((.......)))).)))))))(((((((((((((...((((((.(((.....(((....)))....))).)))))).))))).)))))))))))))).)))).))..))))).)))).....)))...)))))))..(((.......))).......))))))))))...)))))))...)))...))))))))))))).(((.(((((......))))).)))))))))))))((.......))((((((((((((...(((.(.((((((.((((.((.((((((..(((.((.((((((((((((((((((((.((.(((((((((((((((((((....((((.((..(.((((((((((((((((.(((.((((...(((..(((((...((.(((((.....((((((((....(((............)))....))))).)))((..((((((.((((((......................))))))))))))..)).....(((((.(((((((.(((((((((((...))))))..(((...)))....))))).)))))))...))))).))))).)).))))).))))))))))((((((.((........)))))))).))))))))..)).)))))).)..)).))))..)))))))))))....))))))))......(((((.((((((((.((..(((((((..........)))))............(((((..(((.(((.......)))..))))))))((((.((((((((((.(((((...............((.((.((((((((.(((((..((((((....(((((......)))))....(((((...((.(((((((((((((((((.(((......))).))))..........(((((......(((.......)))......))))).))))))).((((.((((.(((....)))))))))))((..(((((((.(((..(((((......((.(((((((.((((........)))).)))).)).).))......))))))))..)))))))..)))))))).))...)))))..((((((((........)))).))))....((((...))))....(((((...)))))....))))))((...((.(((...(((....)))..))).))...))((((((..(((((((....))..)))))......(((((((...(((.(((....))).)))..)))).)))((((((((((.((((((((((....((((..((((((...(..(.(((.((((((((...((.(((.(.(((.(((((.((((..((((((((((...((((((.(((......((((....((((.((..........)).))))....))))......))))))))).....((.((.(((((....))))).)).))((((((....))))))(((((((.((((((....))))))))))))).((((((.......)))))).)))))))))).))))))))).))))))).))...)))).)))).))).)..)...)))))).))))..)))))))))).(((((((((.((.((((.(((((((((....(((((((.((.(((..........(((.......(((.(((....))).))).....))))))..))..)))))))..)))))))))....)))).)).)..))))))))...((((((((((.....)))))))..)))..))))))))))...((((((((((((....))).......((.....)).((((((.......)))))))))))))))))))))...)))))..)))))))).)).))))))))))))))))).))))...))..)).))))))...))...))))))).)).))).)).))))..))))))))).)))))..)))..))).)).)))).))))))).)))......(((((......))))).....)))))))))))).((((((..((((((...)))))))))))).
Thermodynamic Ensemble Prediction
,(((((((,,...{(.((....,)},)})))))))|,,((((((((((..(((..((((((((((.(((((((((((((((...{((|.{,,{{((({.{{,((,,,,,|.||,|,,||}|||,{{||||||||(((.(({(({{{,...||||{|||||||(((((((((((((...((((((.(((.{...(((....)))....))).)))))).))))).))))))))),||,|{||||.,,.}))))).))}}.....)))},,)))))))}}}}}.}))(((((((((.......,)))))))))}))))))...))).,,))))))))))})),{((.{((({......})))}.)))))))))))))},,|,....}}{((((((((((({{{((..,.(((((({(,,{.((.(((((,,.(((.((.((((((((((((((((((((.(({(((((((((((((((((((....((((.((,.(,({({((((((((((((.(((.(((,..{(((..(((((...((.(((((.....((((((((....(((............)))....))))).)))((..((((((.((((((..,................,..))))))))))))..)).....(((((.(((((((.(((((({({{{..,||||||..{{(,..,|)|.|,))))).)))))))...))))).))))).)).))))).)))))))}))((((((.((........)))))))),)))))))),,)).)))})),...}),))))..)))))))))))...,|||}}}})},,...{{{((.((((((((.((..({(((((........,.})))}.....,{|,.{{(((,{..,,(,,{{.,,..,,,))}})))}),,(((((.((((((((((.(((((...{,{{.....,{{(({(((((,(((((.,(((,.((((((((.{,(((((......}))))(((({...))))}...,(((((((.{((((.({{{{{,{.|||}||}|{(({{{{|,|{{(((,,{{{{{{((,.|,....,,.||.,|||{,{{{.,,{|||..,,..||||||||}.,||,||||,.||.||....,,|}..,.((((((((......((({.(((((((((((..........(((((.(({,(,{(..,(,((((..((((((.((((((.,,{{.((,.......||.{|.({((((((.,,,....}}}}.}))))),,((({...}))).,{,((({(..,||}},...,}},})},.}}}||}||,,...,.)))))).,})))))..)))),)}.,..))}))))))))..))))))))},....(((((((...(((.(((....))).)))..)))),,)).}}}}.)))})))))))).,(((((((.,...,.||}}}}}....,||.|||}||||}}.,|}|}|}}},,}}||||..((((..((((((((((...((((((.(({..,,..((((,{,.(((({((,.....,}}}),,)))).|}.}))).,,,.,))))))))).....((.((.(((((....))))).)).))((((((....)))))){((((((.((((((....))))))))))))}.((((((.......)))))).)))))))))).)))))))))))})||||.},.,)))))},,)).)))))))))))),),)))))))},))..))))),.(((((((((((((((((,(((((((((....(((((((.{{.{({.,,.....,|.{{,......(((.(((....))).)))......)))))..},..)))))))..)))))))))....,.||{|{(({{{...||{..,(({({,,,,||}},,.,))),)))))),..}},.,},......{{,.((((((......))))))...,|{.....)).((((((.......))))))..,}})))))))))))))))))))}))),))))}})),.))))))))))))))).)))))..))..)).)))))),,.)),..))})))).})}))).)).))))..))))))))).))))}..,,,...,,.||.,,,},)},,,,)})))}}.,..}}}})))}...,)))))....)))))))))))).{(((((..((((({...,)))))}))))}.

Transcripts

ID Sequence Length GC content
AACAGAGCCACCUUCUGCGUCCUGCUGAGCUCUGUUCUCUCCAGCACCU… 2238 nt 0.5688
Summary

The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the basal layer of the epidermis with family member KRT14. Mutations in these genes have been associated with a complex of diseases termed epidermolysis bullosa simplex. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human skin wound healing demonstrated that the KRT5 is a highly expressed keratin marker used for keratinocyte identification in single-cell and spatial transcriptomic analyses of acute and chronic wound-edge tissues [Liu et al. DOI:10.1016/j.stem.2024.11.013]. A study in humans demonstrated that the KRT5 is a cytoskeletal protein used for wound age estimation, where the absence of positive keratinocytes indicates a wound age of less than 19 days [Cecchi DOI:10.1007/S00414-010-0505-X].