Basic Information

Symbol
KRT6A
RNA class
mRNA
Alias
Keratin 6A KRT6D CK6C CK6D K6C K6D Keratin, Type II Cytoskeletal 6A Keratin 6A, Type II Type-II Keratin Kb6 KRT6C K6A Keratin, Epidermal Type II, K6A Keratin 6A, , Type II Allergen Hom S 5 Cytokeratin 6A Cytokeratin 6C Cytokeratin 6D Cytokeratin-6A Cytokeratin-6D Keratin 6C Keratin 6D Keratin-6A CK-6C CK-6E CK-6A CK-6D CK6A PC3
Location (GRCh38)
12:52487176-52493257
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Tissue/body fluid identification Individual identification
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_005554.4
Sequence length
2308.0 nt
GC content
0.5585

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-880.70 kcal/mol
Thermodynamic ensemble
Free energy: -920.83 kcal/mol
Frequency: 0.0000
Diversity: 546.52
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((.((((((((...((((.((((((((.................((.((.(((((((..(((.(((((((...((((((((((((.(((((((.(((.((.(((.((((((..((.(.((.......))).))..)))))))))..)).))).)))))))..(((.(((.(((((((((......)))))).))).)))))))))))))...)))))...))))))).))).((((((...(((.((((((((.....((((((..((....)).))))))....)))....))))))))..))))))..(.((.((((((((.((....)).)))))))).)).).))))))))))).(((((((((....)))))))))....((((((((((((((((((...((((((...))))))((((((((.(((..(((((((..((.(((((((...)).))))).)).)))))))..)))..)))))))).((((..(((((....((((((.......(((.(......).))))))))).(((((..(.(((.....))).)..)))))......((((.(((((((...........((((.((((...(((((((.(....((((((((...(((...(((.(((((((.....)))))))..)))....)))....))))))))....).))))))))))).))))............))))))))))).((((....))))))))).))))))))))))))).))))))).)))))).)).))))...)).))))))(((((..........))))).............(((.(((((..(((((.((......))..))))).........(((((((((((((.........(((((((.((((........))))....((((......)))))))))))..((((((((((((.(((.(((((..((((..(((((........)))))..))))..)))))(((((((((((.(..((............))..).)))))))))))......((((..(((((..(((.((((((((..((((.....((((((((((((((((..((((.((((........)))).)))).((((..((....))..)))).....(((((..(((((..........))))).....((((((.(((.((.((.((((((((........)))).))))((((((((((((.((.(((((..(..(((.(((((((((((((((((((((.((((((.((((....((((((....))..))))........(((..(((((........))))).))).(((((.....)).)))..))))))))))......((.((((((((((((....))).))))...)))))))((((......)))).((((((.(((((((((((((((.........(((((.((.(((.(((.(((((.....))))).))).))).)).)))))))))..)))))))))))...)))))).....)))))))))))))))...)))))).).))..)..))).)).)).)).)))).)))))).....(((((((.((....)).))))))).(((((...))))))).)).))).))))))(((((((((((.((.((........................)))).))))))))))).(((((((...((((....))))......)))))))..))))).))).))))).))))......))))...))))..)))))))).)))))))).))))(((((((.(((((.(((.((((......))))..))))))))....(((((((((...(((((..........................((((((.....))))))..((((((......)))))).((((((....))))))....((((((((.......((((.........)))).......)))))))).........))))))))))))))..............(((((...........))))).....))))))).......)))..))))...................))))))))........(((........)))(((......)))..)))))))))))))(((((((((.(.((...(((.((.((.(((((.....))))).)))).)))..)).))))))).)))))))).)))............)))))).............
Thermodynamic Ensemble Prediction
.,,,((((((.((((((((,..((((.((((((((..(((.(((((((((((...(((((.(((({.(((.(((((((.,.((((((((((((.(((((((.(((.((.(((.((((((..{{.(.((.......))}.))..)))))))))..)).))).)))))))..(((.(((.(((((((((......)))))).))).)))))))))))))...)))))...))))))).))).((((((...(((.(((((,{{{,..{((((,,..{{..,,||.}}))))}}}})..)},.))))))))..)))))).,(.((.((((((((.((....)).)))))))).)).)}}}{{(|,{,({{(((,,,,.{{,((.((((.(((....(((((((((.,{({((((({.{{{{{{{{{,.,|||{|((({((((((,,.((,...,,.}.}.)))))).,|||}.}})))).)})))))))}}),)))))))))..)}).)))))).,.,}}.,)))))).})))).,..))))).))))).))))))))))).)))............,{{{,.......,{{{((((((((...........((((.((((...(((((((.(..,.((((((((...(((...(((.(((((((.....)))))))..)))....)))....)))))))).,..).))))))))))).))))............))))))))))}.((((....))))})}}..,||||,.,||||..,.)}).)}..)))))).)).))))...)).)))))}(((((..........}))))..,....,...,,({(,(((((.,(((((.,,,....,||..}}}}}.....,,..(((((((((((((.........{((((((.((((........))))....((((......))))))))))}..((((((((.,{{,,{{,(((((..((((..(((((........)))))..))))..)))||(((((((((((.(,.({............))..),))))))))))),..{,,((((..(((((..{({.((((((((..((((...,.(((((((,,((((((({{((((.((((........)))).)))){((((..,,....)),,}),|,{.{{(((((..(((((..........))))).....((((((.(({.((.(..((((((((........)))).)))){{(((((((({(.(({(((((.((,.(((.(((((((((((((((((((((,.(((|{.{(((,...,|||||,,..}}.,})},........(((,.(((((........))))).)}}..((((..||.}|.|.},,},|||)}))|......,,.{((((|((({{{....))),.))),,,)))))}}((((.....,)}}|.((((((.(((((((((((({,{.(((.((({.,,,..,{.(((.(((.(((((.....))))).))).))).})))).))),)}.})))))))))))...)))))),,,)})))))))))))))))...)))))),},}|,||..}},|}}.}),}}.}})),}))})),}}.,||(((((.{{.,,.)).)))))}}{(((((...)))))))},)}))).)))))){((((((((((.((.{(......................,,}})).))))))))))|.(((((((...((((....))))......)))))))}.))))).)))})))))),))}},,})))))).}.))))..)))))))).))}))))).))))..,{|||{{((((.(((.((((......))))..))))))||{((((({({{{((,,..,,||,..............,,,,,,,,...{(((({.....)))))}..((((((......)))))).((((((....))))))....(((((((({......((((.,.......)))).....).)))))))).........})))))))})))))}},.{,,{{{{{{{(((({...{{{{{...,,,))}}}..}})))))).}}}}}}}.{{,....,,,...........,,..)))))))).....,,,{{{........)))|{|,.....))}..))))))))))))){{{((((({,{.{,...(((.{,.((.(((((.....))))).))}).)))..,,.))))))),)))))))),)))..,||,......}))))).............

Transcripts

ID Sequence Length GC content
NM_005554.4 NCBI
AGUCCUGCUUCUCUUCCCUCUCUCCUCCAGCCUCUCACACUCUCCUCAG… 2308 nt 0.5585
Summary

The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. As many as six of this type II cytokeratin (KRT6) have been identified; the multiplicity of the genes is attributed to successive gene duplication events. The genes are expressed with family members KRT16 and/or KRT17 in the filiform papillae of the tongue, the stratified epithelial lining of oral mucosa and esophagus, the outer root sheath of hair follicles, and the glandular epithelia. This KRT6 gene in particular encodes the most abundant isoform. Mutations in these genes have been associated with pachyonychia congenita. In addition, peptides from the C-terminal region of the protein have antimicrobial activity against bacterial pathogens. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Oct 2014]

Forensic Context

A study in humans identified the KRT6A as a stable mRNA marker for saliva identification, showing vast overexpression in saliva compared to semen and tissue-specific expression in stains aged up to 180 days [Zubakov et al. DOI:10.1007/s00414-007-0182-6]. A subsequent developmental validation of an mRNA-cSNP panel confirmed the KRT6A as a saliva-specific marker for identification and individualization, though it noted its presence in vaginal secretion samples due to cross-reactivity from epithelial tissue expression [Liu et al. DOI:10.1007/s00414-025-03434-0].