| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCCUGCUUCUCCUCCCUCUCGCCUCCAGCCUCUCACACUCUCCUAAGC… | 2302 nt | 0.5652 |
The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. As many as six of this type II cytokeratin (KRT6) have been identified; the multiplicity of the genes is attributed to successive gene duplication events. The genes are expressed with family members KRT16 and/or KRT17 in the filiform papillae of the tongue, the stratified epithelial lining of oral mucosa and esophagus, the outer root sheath of hair follicles, and the glandular epithelia. Mutations in these genes have been associated with pachyonychia congenita. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the KRT6B is a tongue tissue identification marker, as it was detected in a human tongue total RNA sample using the Oxford Nanopore MinION direct RNA sequencing kit [Dunn & Fleming DOI:10.1080/00450618.2019.1571105]. In a separate investigation of UVB-induced inflammatory pain, the KRT6B was found to be up-regulated in both human and rat skin, with a fold change of 15.4 in human skin and 16.0 for its rat orthologue, indicating its role in cell stress and wound healing [Dawes et al. DOI:10.1371/journal.pone.0093338].