Basic Information

Symbol
KRT6B
RNA class
mRNA
Alias
Keratin 6B KRTL1 Keratin-Like 1 (A Type II Keratin Sequence) Keratin, Type II Cytoskeletal 6B Type-II Keratin Kb10 Keratin 6B, Type II CK-6B K6B Keratin, Epidermal, Type II, K6B Cytokeratin 6B Cytokeratin-6B Keratin-6B CK6B PC2 PC4
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_005555.4
Sequence length
2302.0 nt
GC content
0.5652

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-903.60 kcal/mol
Thermodynamic ensemble
Free energy: -940.06 kcal/mol
Frequency: 0.0000
Diversity: 523.44
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.((..((((((((((.((..(((((((((((((...(((((..((((((.((((.((((((.(((.(((((((...(((((((((((((((..((((..(.((.((((((((((((..((((((..(..(((...)))((((.((((((((.(((.(((((((((((((.(((((((((.((((.(((((..((....)).))))))))).))))..))))).))))...)))).))))).)))..)).)))))).)))).((((((..((....)).))))))..(((..(((((((((.(((....))))))))).))).))))..)))).))..))))))))))))))..)..)))).))))))...)))))))))....))..))))).))))))))).))))))....((((((((((((((...((((((..(((((((..((.(((((((...)).))))).)).)))))))..))).....(((((....)))))...((((........))))))).)))).)))))))).))))))..))))).))))).)).......................((((((((...........((((.((((...(((((((.(....((((((((..(((....(((.(((((((.....)))))))..))).....)))...))))))))....).))))))))))).))))............))))))))))))))......)).))))))..))))..))..))))..(((((.((((((((((((((((((.....))).(((((..........))))).............((.....))..(((((.((......))..))))).((((((((((.(....((((..........(((....((((((((..(((((((((((((((.(((((((((...(((.(((((((((..((.(((..((((...((((..(((((........)))))..))))..(((((((......))))))).............(((((((((((((((......)))((((.((((...((((.((((((((..(((((((((.(((((((((.(((((((((((.((((........)))).)))).((.((((((.((((.....((((((.((..((.((..(((((.((.....)).).))))..)).))..)).)))).)).....)))).)))))))).....(((((((((((..((...((((((((..(((((((((((((((((((((.((((...(((((.......)))))....))))........(((((.(((((........))))).(((..(((((.((..(((......(((((.(((.........))).)))))......)))..))))))))))...((((......)))).((((((.((((((((((((.((.(((.((((.........(((.(((.(((((.....))))).))).)))..)))).)))..))))))))))))))...))))))))))))))))))))))))))...)))))))))((((..........))))..))))).)).)))))))).))).((((((.......((..(((.(((...))).))).))(((((.((..(.((((((((((.((.((........................)))).)))))))))))..))))))).(((((....)))))))))))....)))))))...)))))))...)).))))).........))))..)))))))).)))))))).))))..((((...))))......((((((....))))))....((((((...(((.((((((((((((((((((((((....((((....(((((((((......))).))))))...))))......(((((....))))).....................)))))))).)))..............))))))))))))))....))))))..................))))))))))))..((((.(((((((....))))))).))))........)))).)))))..)))...))))))))))))))))))..)))..)).))).))).))))..))))))))...)))....))))..).)))).)))))).(((((...)))))))))))).)).)))))).)))))..((((.(((((((((((....))))))........))))).)))).
Thermodynamic Ensemble Prediction
((((.((..((((((((((.((..(((((((((((((...(((((..(((({(.((((.(((((,,(((.(((((((...(((((((((((((((,.((((..(.((.((((((((((({..((((((..{,..||,.{{{{((((,(((((({{.(((.((((({{((((((.(((((((((.((((.(((((,.({....)).))))))))).)))}..))))).)))),},,})).))))).))},.},.}))))),))))}|((({{..{{..,,||.}})))),.|||..|||||||{|,|||.}},))),}|}||.|||,)))|.,}}),.))..))))))))))))))..)..)))).}}))))...)))))))))....))..))))).))))))))).)))))}|,,,((({{{{{(({({{...((((((..(((((((..((.(((((((...)).))))).)).)))))))..}}}.....(((((....)))))...{({,...,,,..,}}}}|||||}}.}}}))))),))))))..))))).))))).)).............,,.....}},((((((((...........((((.((((...(((((((.(..,.((((((((..(((....(((.(((((((.....)))))))..))).....)))...)))))))).,..).))))))))))).))))............))))))))))))))......)).))))))..))))..))..))))..(((((.(((((((((((((({(((.....))).(((((..........))))).............((.....))..(((((.{{.....,}}..))))).(((((({(((...{{{((((..........(((....((((((((..(((((((((((((((.(((((((((...((,{(((((((((..,{{(((,.((((.,.((((..(((((........)))))..))))..(((((((......))))))).............(((((((((((((((......)))((((.((((,,.((({.((((((((.{((((,{{{|}|||((((((((((((,,((((.((((........)))).)))),{(,({{{{{.{{||.....{{((((.((..((,((,,({{{,.{{..,,,)).}.})))..}).))..)).)))).)).....}}}}.}})))),}.,,,.(((((((((({,,({.,.(((({{((..(((((((((((((((((((((,((((.{.(((((.,....}))}))....))))........{((({.(((((........))))).|||..(((({,((..(((.,....(((((.(((........,))).)))))......)))..)))))))}}|,..((((......)))).((((((.(((((((((((({((.(((.((((.{({.....(({.(((.(((({.....))))).))).}))..)))).)))..))))))))))))))...))))))))))))))))))))))))))...))))))))}((((,..,...,,.))))..))))},)}.))}}}}}|||||.{(({((.....,{(({{{{(,(((.{,|||{||,.,)||||||||.}||||||||{(((.((.,(,...........,..........,}})),))))))}))))..)))))}}.(((((....)))))))))))))),)))))))},.}})}|}},..|||,,,}},,}}}.,,}))))..)))))))).)))))))).))))..{{((,.,}}}}.,,...((((((....)))))),,,,((((({...(((.((((((((((({{{((((((((....((((....(((((((((......))).))))))...))))......(((((....)))))......{|,......},,...)))))))).))),.............))))))))))))))....})))))........,{{,...})}))))))))))))..((((.(((((((....))))))).))))........)))).}))))}})))...))))))))))))))))))..)))..)),}))},)).))))..))))))))...)))....)))}.}).))}).)))))),(((({...}))))))))))).)).)))))).))))).,{{((.{((((((((((....)))))))}||.,..})))).)))}.

Transcripts

ID Sequence Length GC content
GUCCUGCUUCUCCUCCCUCUCGCCUCCAGCCUCUCACACUCUCCUAAGC… 2302 nt 0.5652
Summary

The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. As many as six of this type II cytokeratin (KRT6) have been identified; the multiplicity of the genes is attributed to successive gene duplication events. The genes are expressed with family members KRT16 and/or KRT17 in the filiform papillae of the tongue, the stratified epithelial lining of oral mucosa and esophagus, the outer root sheath of hair follicles, and the glandular epithelia. Mutations in these genes have been associated with pachyonychia congenita. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the KRT6B is a tongue tissue identification marker, as it was detected in a human tongue total RNA sample using the Oxford Nanopore MinION direct RNA sequencing kit [Dunn & Fleming DOI:10.1080/00450618.2019.1571105]. In a separate investigation of UVB-induced inflammatory pain, the KRT6B was found to be up-regulated in both human and rat skin, with a fold change of 15.4 in human skin and 16.0 for its rat orthologue, indicating its role in cell stress and wound healing [Dawes et al. DOI:10.1371/journal.pone.0093338].