Basic Information

Symbol
KRT7
RNA class
mRNA
Alias
Keratin 7 CK-7 SCL K7 Keratin, Type II Cytoskeletal 7 Sarcolectin K2C7 CK7 Keratin, 55K Type II Cytoskeletal Type-II Keratin Kb7 Keratin 7, Type II Cytokeratin 7 Keratin, Simple Epithelial Type I, K7 Type II Mesothelial Keratin K7 Cytokeratin-7 Keratin-7
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_005556.4
Sequence length
1625.0 nt
GC content
0.6197

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-700.10 kcal/mol
Thermodynamic ensemble
Free energy: -727.38 kcal/mol
Frequency: 0.0000
Diversity: 381.50
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((....)))((((.(((((((((.(((((.((((......)))).)))..((((((((......(((((((((((........((((((((((..(.(((((...((((.((((.((.((((....)))).)).))))..)))).((((((((...((((.(((((((((((((((.(((((((....)).))).)).))))))).(((((((((...((.((((...)))).))(((((((((((((((.((....((((.(.(((((..((.((((.(((((((..(((((((..((((((.((((((((.(((..(((((((.((((((......................)))))))))))))(((.....)))..(((((((..((((((.......)))))))))))))..))).)).)))))).))).).))..))))))...)..)))))))((((((..(((((...((((((((...((((((((...))))))))))).))).))..)))))..))))))(((((....)))))....)))).))..))))).).))))))..))))))...........................(((((((.((((..........)))))))))))((.....))...)))))))))(((.....).)).)))))))))((((((((..(((..((.(.(((((........((((((((((((..........))))..))))))))((..(((((.(.((..(((((((((........((((((((((((.((....(((.......)))..)))))))))))))))))..))))))..)))))))).)).((......)).....((((((((((((((((.((((.((((.....)))).)))).))..))))..))))).)))))........((......))(((((.....))))).......))))).)))..))).)))).))))))))))))..))))...................(((((.......)))))))))))))......))))).)..)))))))))).((((((((...((....)).))))).))).)).))))))))).((.((((((...))))))..)).))))))))...(((((((.(((((((.......))))))).(((.(.((.((((.((.(....).))...)))).)).)))).))))))))).))))))))))))).(((.((((((((.(((((((((((.((....((((.....))))....((((((.((....)).))))))(((.((((((..((((.(((..((.....))..)))))))))))))))).(((.....))).((((((.(((((((((......))))))........)))))))))..(((((((((.((....)).))))))).)))).)))))...))))))...)))))))))))...(((.(((((....((((((.(((..((.....(((....))).....))...))).))..)))).....))))).((((....((((......)))).((((((...))))))))))))).....
Thermodynamic Ensemble Prediction
.(((....)))((({{(((((((((.(((((.((((......)))).)))..((((((((......(((((((((((,,,....,((({((((((.,(.(((({...{|||.||{|,||.({{(.,.,))}}.||,||}|.,||}|,{{(((((({{{((({.(({((((((((((((.(((((((....))}})).)).))))))}.(((((((((...((.((((...)))).))(((((((((((((((.((,...{(((.{.(((((..((.((((.(((((((..{((((((..(({{((,({(((({{{((({,(((((((.((((((......................))))))))))))){((.....)))..(((((((..((((((.......)))))))))))))..,)),}),)}}))),}))}).))..))))))...}..)))))))((((((..(((((...((((((((...((((((((...))))))))))).))).))..)))))..))))))(((((....)))))....)))).))..))))).}.))))))..))))))...........................(((((((.((((..,....,..))))))))))){{.....,}...))))))))}(({.....}.)).))))))))){(((((((..(((.,,{,(,((({,........((((((((((((.{,...,}..))))..))))))))|,..(((((.{,{{,.{((((({{,.....,.{((((((((((((.((....(((.......)))..))))))))))))))}|}{,}}}}}}..))}))))}.},.||,,.|,|||..,{,((((((((((((((((.((((.((((.....)))).)))).))..))))..))))).))))}.,..}},,||}}.,..))|((((.....))))}.......})))).},),.))).)))).))))))))))||,.||||.(.({...........}}.|||||.}}}...}})))))))}))}..,},,))))),).,)})))})})),|||(((((...,|...,}}.))))),,)).)).))))))))).((.((((((...))))))..)).))))))))..,(((((((.(((((((.......))))))).(((.(.((.((((.((.(....).))...)))).)).)))).))))))))).))))))))))))).((,{((((((((.(((((((((((.,(,{..,(((,....|||}....|{((((.((,...}},}}}}}|{(({(({,,,{{({({.{{{..((({{,.||{.|||||}},,)))))}).|,|,}}}},||.{{(({{{({{{((({{,,.,,.))}}}}.,},,.,.)))))))}}..||(((((((.((....)).))))))).)))),)}})),}}}})))).,.))))))))))),......{(({{..,..,,|,..||,..{{{.{||,|,{{,|{,,,,.,.||,|,|,},},)})}}|||,,,||.||.,,,,.,..||||,,....,}}}.((((({...})))))}}),)))},...

Transcripts

ID Sequence Length GC content
AGCGAGUGCGCGCUCCUCCUCGCCCGCCGCUAGGUCCAUCCCGGCCCAG… 1625 nt 0.6197
Summary

The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the simple epithelia lining the cavities of the internal organs and in the gland ducts and blood vessels. The genes encoding the type II cytokeratins are clustered in a region of chromosome 12q12-q13. Alternative splicing may result in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human samples demonstrated that a panel of 19 cytokeratins, including the KRT7, was tested for discriminating epithelial cell origins in forensic swabs [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X]. The research found that the KRT7 was only minimally or not at all useful for the specific sexual-assault questions under investigation, unlike other cytokeratins such as Ck4 and Ck10 which were effective for distinguishing mucosal from skin cells. A study in Drosophila demonstrated that the micropeptide Sacrolamban (Scl), derived from a long noncoding RNA, mediates calcium reuptake in cardiomyocytes by regulating SERCA activity [Chih-Fan Yeh et al. DOI:10.1186/s12929-020-00647-w].