| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCGAGUGCGCGCUCCUCCUCGCCCGCCGCUAGGUCCAUCCCGGCCCAG… | 1625 nt | 0.6197 |
The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the simple epithelia lining the cavities of the internal organs and in the gland ducts and blood vessels. The genes encoding the type II cytokeratins are clustered in a region of chromosome 12q12-q13. Alternative splicing may result in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
A study in human samples demonstrated that a panel of 19 cytokeratins, including the KRT7, was tested for discriminating epithelial cell origins in forensic swabs [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X]. The research found that the KRT7 was only minimally or not at all useful for the specific sexual-assault questions under investigation, unlike other cytokeratins such as Ck4 and Ck10 which were effective for distinguishing mucosal from skin cells. A study in Drosophila demonstrated that the micropeptide Sacrolamban (Scl), derived from a long noncoding RNA, mediates calcium reuptake in cardiomyocytes by regulating SERCA activity [Chih-Fan Yeh et al. DOI:10.1186/s12929-020-00647-w].