| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCCUGCACUUGGGAGCCGGUAGCACUCCUAUCACUGCUUCUCAACCCG… | 2296 nt | 0.5483 |
This gene encodes the type I keratin 9, an intermediate filament chain expressed only in the terminally differentiated epidermis of palms and soles. Mutations in this gene cause epidermolytic palmoplantar keratoderma. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the KRT9 mRNA, specifically expressed in palmar and plantar skin, showed strong over-expression in skin samples relative to forensic body fluids and was part of a sensitive qPCR assay for skin identification from thumbprints, albeit with detection success decreasing in smaller print samples [Visser et al. DOI:10.1007/s00414-010-0545-2]. A subsequent collaborative exercise in humans confirmed the KRT9 as a skin-specific marker within a multiplex assay but noted it showed poor expression in low-template contact traces and was only reliably detected at high RNA concentrations [Haas et al. DOI:10.1016/j.fsigen.2015.01.002]. A study in human samples demonstrated that a panel of 19 cytokeratins was tested for discriminating epithelial cell origins in forensic swabs, where the KRT9 was found to be only minimally or not at all useful for the specific sexual-assault questions under investigation [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X].