Basic Information

Symbol
KRT9
RNA class
mRNA
Alias
Keratin 9 CK-9 K9 EPPK Keratin, Type I Cytoskeletal 9 Type I Cytoskeletal 9 Keratin 9, Type I Cytokeratin 9 Epidermolytic Palmoplantar Keratoderma Cytokeratin-9 Keratin-9 EPPK1
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_000226.4
Sequence length
2296.0 nt
GC content
0.5483

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-857.20 kcal/mol
Thermodynamic ensemble
Free energy: -898.20 kcal/mol
Frequency: 0.0000
Diversity: 625.51
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((.(((((....((((.((((.(.(((.(((((((((((....(((.(((((((...((.((.(...((((((...((.((((((((..(((((((...((((...(((.((((((((.((((.(((((..((.((....)).))...))))).))))...)))))))).)))((((((((((..((((((.(((((((.(((((..((((.((.((((((.((((.((((..(((.((((.(((.(....).))).)))).)))..)))).)))).)))))))).))))((((((((.((((((((....((((.(((...(.(((.(.((((((((....)))))))).).))).)...))).))))..))))))))....((((((((...((((.((.(((((.(((((((((((((....((((((((..((.(((((..((((((((.((((((.(((..(.(((((((....((.(((((.(((....((((((((.(.((((...........)))).).)))))).))....))).....(((..(((((((((.((.(((....((....))))))))))))))))....)))((((((........))))))...))))).))....)))).))).).))).))))))....))))))))............((((((......(((.((.(((.....))).)))))))))))..............(((((((((((((((..((((..(.((((((((((((.(((((.......((((((..((((((...((((((.(((.((....((((....)))).....))))).))))))))).......((..((.((.(((.((((.(.(((......)))..).))))))).)))).))(((((((..(((((...............)))).)....))))))).((((.......))))...((((((..(((.(((((.....(((((...)))))..)))))...........((((((..(((.(((......))))))..))))))......))).....))))))(((..(((...)))..))).......)))..)))))).)))))))))))))....)))))..))))..)))..(((((..((((.((...)).)))))))))))))))))))))...(((((((.....)))))))))).)).))..)))))((((((.....)))))).......)))..))))))))))))).))))).)).))))...)))).))))..................)))))))).((((..((.((((..........)))).)).)))))))).).))))))).))).((((....))))((((.((........)).)).))...)))..)).))))))))..(((((.....(((((...(((.(((.(((((.....(((..(((((((..((.......((.((....)).))......))...))))))).....))).....))))).))).)))....))))).....)))))...))))...)))))))....))))).))).))...))))))...))).))...)))))))))).)))))))))))))).))))))))).....))))).))).)......((((.((((((....(((((((..(((.(((..(((((((((.(((.((.((((..(((.(((((.(.........).))))).))).....((((((((.((((((((((((((....(((((((..((((((.(((..((((.(((((....))))).)(((((.((.(((((((((.........(((((.(((((((((.((.(.....(((((((((((((((..........))))..).))))))))))......).)).)))...............)))))).))))).........)))))))))..)))))))(((.((((....)))).)))..(((((((((((......(((((((.......))))))).(((((....)))))((((..(((.....))).))))))))))))))).....)))..))).)).)))))))))))..)))))).)))..(((((((((((...(((......)))..))))))))))).....))))).))))))))))))..)))))..)))))))))..))).))).....)))))))......))))))...))))........
Thermodynamic Ensemble Prediction
.,(((.(((((....(((,,((((.(.(((.(((((((((((,..,(((.(((((((...((.(,{(.,.((((((...((.((((((((..(((((((..,((((...,((.((((((((.((((.(((((..((.((....)).))...))))).))))...)))))))).|||(((({{{{{(,.((((((.(((((((.(((((..((((,((.((((((.((((.((((..(((.((((.(((.{....}.))).)))).)))..)))).)))).)))))),}.)))){{((((({{.(((({((..,{(({,..{{...,|{{{|{||{{({{{{.,..|||||||{{{,{{{,{..,|||||||||,||||||}|.,,.{{((({((,..((((.((.(((((.(((((((((((((.,,,(({{({{((((({((..{{.((((((((.{(((((.(((..(,(({((((....((.(((((,(((....((((((((.{.((((.,.......,.)))).}.)))))).))....))).....{{{..(((((((((.{(((((....{{....}}))))))))))))))....}}}((((((........))))))..}))))).))....)))).))).).))).)))))}....))))))))...,..,,..)))))},}.,.}||||.(((.(((.....))).)))....|{{|,,..,..|....,.(((((((((((((((..((((,.{.(((((((((((,,(((((.......((((((..((({((,..((((((.(({,((.,,.((((....)))).,,..))))).))))))}}),.....{((..((.((.((,,((((.,.(((......)))..,.))))))).)))).}}{((((((..(((((.........,.....)))).)....))))))}.((((.......)))).,.(({(((..{((,{{{{{...,,|{(((||,||}}}..}}}}}.,...,...|||,.{||,.|{,}|||}}}}},}}||||,.}}}}))}}.....,......}})}||(((..(({...}))..))).,,....)))..)))))).)))))))))))))....))))}..))))..)))..(((((..((((.((...)).)))))))))}))))))))))),,}|||||(((((({.,...,)))))))((......))((((((.....)))))),,,,,,.)))..))))))))))))).))))).)).))))...)))))))}},.,||||...}}}}},..)))))))),||||,.||.||||.,,,,.}...)))),)).)),})))).}.))))))).))}.{{{{....})))||||.||,.,,,...}}.,}.|||.||||..|||||||||}}{,(((((,....{((((...(((,((|,|{{{{.....,||,,||||{{{..||,,,,,,,{{,||,,,,)}.}}.,,,..,,...)))))))....,}}),....))))).},},))),}}.)))))...,,))))).,.))))...)))))))....))))))})}.))...)))))).,}))).))...)))))))})).))))))))))}))).))))))))).....))))).))).|......(((({((((((....(((((((..(((.(((..(((((((((.(({.((.((((..(((.(((((.{.........}.))))).))).....((((((((.((((((({((((((...{(((((((..((({((.(((..(((,,({{((,.,,{....,,(((((.,{.(((((((((..,......(((({.(((((((((.((,{.....(((((((((((((((..........))))..).)))))))))).....||,}}.})),...,..........)))))).))))).....,...)))))))))..}})))))|||.{{||}}}}})}}.))}..((((((((((({.....(((((({.{....}))))))).(((((....))))){{{{..(((.....))).})})))))))))))).,,..)))..))).)).))))))))))),.)))))).})}.{(((((((((((...(((......)))..)))))))))))}).}.))))).))))))))))))..)),})}.)))))))))..))).))).....)))))))......)))))),}.))))........

Transcripts

ID Sequence Length GC content
ACCCUGCACUUGGGAGCCGGUAGCACUCCUAUCACUGCUUCUCAACCCG… 2296 nt 0.5483
Summary

This gene encodes the type I keratin 9, an intermediate filament chain expressed only in the terminally differentiated epidermis of palms and soles. Mutations in this gene cause epidermolytic palmoplantar keratoderma. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the KRT9 mRNA, specifically expressed in palmar and plantar skin, showed strong over-expression in skin samples relative to forensic body fluids and was part of a sensitive qPCR assay for skin identification from thumbprints, albeit with detection success decreasing in smaller print samples [Visser et al. DOI:10.1007/s00414-010-0545-2]. A subsequent collaborative exercise in humans confirmed the KRT9 as a skin-specific marker within a multiplex assay but noted it showed poor expression in low-template contact traces and was only reliably detected at high RNA concentrations [Haas et al. DOI:10.1016/j.fsigen.2015.01.002]. A study in human samples demonstrated that a panel of 19 cytokeratins was tested for discriminating epithelial cell origins in forensic swabs, where the KRT9 was found to be only minimally or not at all useful for the specific sexual-assault questions under investigation [Schulz et al. DOI:10.1111/J.1556-4029.2009.01071.X].