| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCGCGGGGUGCGCCUCUGGGAUAGGCGACCACGGUGUCUUCAAAAGCC… | 967 nt | 0.6494 |
This gene belongs to the ESO/LAGE gene family, members of which are clustered together on chromosome Xq28, and have similar exon-intron structures. Unlike the other family members which are normally expressed only in testis and activated in a wide range of human tumors, this gene is ubiquitously expressed in somatic tissues. The latter, combined with the finding that it is highly conserved in mouse and rat, suggests that the encoded protein is functionally important. An intronless pseudogene with high sequence similarity to this gene is located on chromosome 9. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the LAGE3 was downregulated as part of the metabolism of RNA pathway in the hippocampus, kidneys, and lungs during sepsis [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].