Basic Information

Symbol
LAGE3
RNA class
mRNA
Alias
L Antigen Family Member 3 DXS9879E ITBA2 ESO3 DXS9951E CVG5 Pcc1 EKC/KEOPS Complex Subunit LAGE3 Protein ESO-3 DNA Segment On Chromosome X (Unique) 9879 Expressed Sequence L Antigen Family, Member 3 Protein ITBA2 GAMOS2
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_006014.5
Sequence length
967.0 nt
GC content
0.6494

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-438.20 kcal/mol
Thermodynamic ensemble
Free energy: -455.88 kcal/mol
Frequency: 0.0000
Diversity: 236.09
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((.((.((((((((.((.(((((((((.((........)).))))...))))).)))))))))).)).)))....((((((((((((.(.((((.((((((((.(((.((((.(((....(((((...((((((...))))))....))).))....)))))))))).)).)))).(((((......))))))))))).).))))))))).)))(((((..(((((((((.(((((((((((((((.(((....)))..))).))))))))((((.(((((((((((((..(((........)))(((((((((...)))))))))(((((.(((((((((((((.(((((.(((....)))((.((((((.(((((((((.((((...((.(.(((((((.(....((.((((.(((..((.(.(((...(((((((((......)))).)))))))).).))..))).)))).))...).))))..))).).)).....))))))))))))).)).((((((...(((((.(......).))))))))))).)))).))..(((((((((((((((.((((.....))))...((((...(((((.....))))).))))..)).))))).))))))))((((((((((.....)))...)))))))((((.((.(((....))).)).))))))))))))))))))..))))((((..........)))).......(((.((((.((((.....)))).))))..))).))))).)))))))..)))))).))))..((((..((((((((((...))))))).)))..)))).(((((((.(....((((.((....)).))))...).)))...))))....)))).)))))))))..........))))).........(((((....)))))........)))))......
Thermodynamic Ensemble Prediction
..((((((((.(({((((((((.((.(((((((((.(,{{,...,})).))))...))))).)))))))))).)).)))((((((((((((((((.(.(((({{{((((({.(((.((((.(((.{,.{((((.{.((((((...)))))),...)))}.),...)))))))}}),)},)))).(((((......))))))))))).).))))))))).))),.,))))(((((((((((((((((((((((((.(((....)))..))).))))))))((((.((((({(((((((,.(((.,.....,)))(((((((((...)))))))))(((((.(((((((((((((.((((((({..(({.((....(((((((((((((((.((((...((,(,({(((((,(..{{((,({{{.|||,,,,.{|{||{{.(((((((((......)))).)))))})).)})),.))),)))).)),}.}.))))..}}}.},||.....})))))))))))((((((({((((.,...,|.}}}}...,..||||.{{{{{{..{{{|({((((((((((((((((.((((,...,))))..,(((,...(((((.....))))).),))},))}})))).)))))))))))....}}}..)))).))..})))))))))))))))).,....))})).},))))))))))))))))..))))((((..........)))).......{({.((((.((((.....)))).))))..)))}))))}.}))))))..}))))).)))).,({({..((((((((((...))))))).})),.}})},{(({(((.{....((((.((....)).)))).....)}),.,))))...}))))})))))))))...{{{{,.{{((,,..........,,,.....,)))).,,}},..)))))......

Transcripts

ID Sequence Length GC content
CUCGCGGGGUGCGCCUCUGGGAUAGGCGACCACGGUGUCUUCAAAAGCC… 967 nt 0.6494
Summary

This gene belongs to the ESO/LAGE gene family, members of which are clustered together on chromosome Xq28, and have similar exon-intron structures. Unlike the other family members which are normally expressed only in testis and activated in a wide range of human tumors, this gene is ubiquitously expressed in somatic tissues. The latter, combined with the finding that it is highly conserved in mouse and rat, suggests that the encoded protein is functionally important. An intronless pseudogene with high sequence similarity to this gene is located on chromosome 9. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the LAGE3 was downregulated as part of the metabolism of RNA pathway in the hippocampus, kidneys, and lungs during sepsis [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].