Basic Information

Symbol
LAMA1
RNA class
mRNA
Alias
Laminin Subunit Alpha 1 LAMA Laminin Subunit Alpha-1 S-Laminin Subunit Alpha Laminin-3 Subunit Alpha Laminin, Alpha 1 Laminin A Chain S-LAM Alpha Laminin-1 Subunit Alpha S-LAM-Alpha PTBHS
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Wound age identification

MANE select

Transcript ID
NM_005559.4
Sequence length
9642.0 nt
GC content
0.5080

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3342.60 kcal/mol
Thermodynamic ensemble
Free energy: -3517.30 kcal/mol
Frequency: 0.0000
Diversity: 2505.74
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((((.((((....)))).).))))))).(((((((((...(.((((.(((((((((.(((.((((....(((((((.(((((((..(.(......).)..))))))).))))))).(((.(((((((((((.........)))..)))).....)))).))).((((((((((((((.....(((..((((((((.((..((((((((.((((((((((....)))))))))).)......))))))).))))....))))))....((...((((.((((..((((((...(((((((((...(((((((.........((((.(((.(((((......((((.(((...)))))))((..((((((..(((.((...((((.((((((((((..(((((((((..((.(((....((((((((((((((.(((((((....(((((.(((((.((..((((........)).))..)).)))))(((.((((((((((..(((((((((((.((((((((((((((((...))))..((((..((((......))))....))))((((.((((((((((((.......))).)).((((((.(((((..(((((.................))))).........(((((....)))))..)))))))))))...(((((.......(((((((.(((......))))))))))........)))))..((.....)))))))))))))...((((((.((.((((....((((.(((...........(((.((((((.((.........)).))))........((((.(((.(((((....))))).)).)...))))..)).))).(((((.(((.((((((.((.(((...))))).)))))).).)).)).))).)))..)))))))))))))))).))))))))).))).))).).)))).))).)))))))))).)))........)))))...(((((((((...))).).)))))((((((((((((...)))))).))))))........................)))))))..))).))))).............))))))..)))))....)))))))))..(.((((((..(((.....))).(((((.....(((((.......)))))....))))).((.(((..........)))))..(((..((((((....)))).))..)))...)))))).).)))))))))).))))..)).))).))))))..))......((.(((((.((((((.(((.(((......(((.((((((.((.((.(((((((.......(((..(((((((........((((((.((((((...))))....))))))))....)))))))..))).(((((...)))))))))))).))))........(((((....)))))((((.(((((((..((..((....(((......)))))..))..))))))))))).(((........)))((........))....)))))))))(((.(((.((((...((((((...)))))).)))).)))))).(((((((....)))))))......))).))).))))))..)))))))(((..((((..((....)).))))..)))...(((...)))....(((((.((((((((((((..............((((((((.((.......((((((((........)))).)))).((((((....))))))......))))))))))..((((((((.((((.....)).)).))))........(((((.((((((((...((..((((((..((((((((((.((((((((((....((...((((..(((.(((..(((.(((((((...)))))))...))).(((((.....(((((((.......)))...)))).(((.((((((((....)).))))))..))).)))))))).)))))))..))...))))))).)))...))..)))))))).(((....))).(((((((..................)))))))....))))))..)))))))))))))))....))))((......))....)))))))))))).)))))..((((((.((.......)))))))).((((.((((((.....)))))))))))))))))).))))..........))))))).....))))))).))....(((.(((.(((((((((((.((((......)))).).))...)))))))).))).))).((((....))))((((.(((..((((((((((.((.((((((((...(((((((((...))))))).((((.(((....))).))))......((((((((...(((((.(((((...((((((..((..((((((.(((.((.(((((.((((.(((((((((((((((((((((((((.((((((.(..((((.(((.((((..((.(((((((((((((((.(((......(((....)))((((((...((((.((((.((((((((((..........((((....((((.((((((.(((((((((...)))).))))).)))))).)).)).....))))))))))))))))))..))))))))))....(((((..(((.((((((((((((.(((((((.(((.(......((((((((((((.(.((((...((((..((((..(((....(((((((((((((.((.((.((((.((((.((......(((........)))..((((.((....)).)))).((.((((..((((((.(((....))).))))))..)))))).((((....)))).)).)))))))).)).))))))))).)))))))))..))))....)))).)))).)))))))))))))......).))).))).)))).)))))(((......)))..((((((((((((((.(((((((((((...((..((((((((((.....)).....((((...)))).))))))))..))..........))))))))))).))...((.(..(((((((((((((((((((((.((((.(((((((((((((((.......)))...(((((((.(.(((((.(((.((.(((((...)))))))))).((((((...(((((.............))))))))))).(((.((((..((.(((((((((((((((..((...................))..))))))))))))))).)))))).)))...(((((........)))))((((.(((((..(.(((((((.....(((.....)))...((((((.....))))))((((((...(((.....)))...)))))).))))))).).))))).)))).)))))).)))))))((((((.((....))..)))))).))))))))))))))...((((.(((((.(((((((((.((((((...)))))).)))......((((((..(((((.(((((.(((((..(((..(((((......))..((((((((......))))))))......((((((...(((((((.....((((.((((....))))...))))......))))))).....))))))(((((((((......(((((((((.(((.((((........)).)).)))))))(((((((((((((..(((.(((((((((........((((.....)))).......)))).)))))........(((..((((....)))).)))....))))))))))))))))((..((...........))..)))))))......))))))))).........))).)))))))).)))))...)))))))))))...))))))..))))))))).....((((......))))...(.((((((.(((((((..((((.(.((...)).)))))(((((((((((..(((..((((((((.....)))...((((((((((((.(((((((((...)))))))))(((........)))((..((((((((...((((...))))))))))))..))....)))))).......((((((.(.....(((((((((((((((((.......))))).)))))))))))))))))))))))))........(((((......)))))...))))).))).))))))))))).(((((.......)))))....)))))))..)))))).)...(((((.(......).)))))((.(((.((...)).))).)).)))))))).)))))))))))))))..).))))))))......(((((.(((.(.....).))))))))((((((....)))))).........))))))(((.(((.(((...((((......)))).))))))))).......)))))))))).))))).(((.(((((((((....).)))))))).))).(((((((.(((((((.((((..(((....))))))))))))))...((((((.(((((((((((....))))))((((((((..(((((((..((((((((.((((.......)))).)))))))).(((..(((.(((((....((.((((((((((....(((((.((((...(((....(((((.((((((...((((((..(((.(((((((.(((((((((....(((((..(((((((((.................))))))....)))..)))))....))))).....))))..)))).....)))))))).))))...).))))).)))))...)))...........)))))))))...))))).))))))).......((((.(((......((.(((((((((...((((((.........((((((...(((.((.(((.......))).)).)))...)))))).((((....))))......))))))...))))))))).))....))).))))))))).)))..)))((((......(((((......))))).......))))..........))))))).)))))))).....((((....((((.(((.((((((((..(((.....)))......((.((.......)).))(((((((...((.((((..(((.(((((((..((..........)).))))))).)).)..))))...))...)))))))((((((..((((..(((.((((((((..(((((((((..........)))))(((((.((((...(((............((((((.((((.....(((.(((((((((...........(((....)))((((((((((((........))).)))).)).)))(((((((.(((((((..(((((.....(((.((((((.....)))))).)))((((((..........((((((...((((.......))))...))))))...)))))).........(((.(...(((((.(((.((.(.((((((.((....)).)))))).).))))).))))).).))))))))..)))).))).))))))))))))..))))))).....)))).)))))).....(((((((((((.((..((((.......((((..(((((((....))))..)))..)))).....))))..)).))).)))).))))(((((.(((.(((((.....((((((((((((.((((........))))...((.(((.((((..(((((...)))))((((..((((.(((.....)))...)))).))))..)))).))).))......................((((((((.((....)).)))))))).........(((...((((..((((........))))..)))).....)))...))))))))))))...........))))).)))..)))))))).))))))))).(((((((..((((.((((((((.(((((((..(.((((((((((((..(.((((.((((((.(((((((((((.................)))......((....))..((((....((((((((((((((((((((((((..(((((.......((((((((((((((((((..((....))..)))))......(((.((.((.(((((((((.(((((((.....................(((.....)))..((((((((......)).((((......)))).((.((.((((....)))).)).))....))))))....).))))))))))))))).)).)).)))...(((((((.....))))))).((((((((.(((........(((((...(((((...(((...(((((.(..........).)))))...)))..)))))))))))))..))))))))((((((((...))))))))....)))).))))))))))))))((((.((((((...((((((((((((.......))).)))((((((((....(((((((((((...(((..(.(((((.(((((.....(((((((...................(((((((((.(((((...((..(((((.......)))))..))........((.(((((((((((........))))))..))))).)).((((.(....)))))......)))))))))))))).((((((((..........((((((....))))))............))))))))..(((((((((((....(((.(((...((((((((((.......))).))))))).(((((((((.(.((((.....)))).).)))))))))))).)))..))))............................(((((.((((.......))))..)))))....)))))))....)))))))........)))))))))).).))).)))))((((((....))))))(((((...)))))........((((.....)))).((((((...((.(((((((((((....((((.((((.........))))))))...)))))))..))..)).))...))))))))))))..........((...((((((((.(((((((..(((.(((.((((((...(((((((.(.(((.......))).).))))))).......)))))).))).))).......((((....)))).........(((((((.((........(((((....)))))..((.(((((..(((((((.............))))))).))))).)).....)).)))))))))))))).)).))..))))...)).(((...........)))..)))))))).(((.(((((...........))))).))).(((((....(((.(((((.((((..((((((.((((....)))).)))))).(((((((.(((((...((((.(....).)))).))))).)))))))))))))))).)))..))))).....(((((.........((((((((..(..((((...(((.....))).))))..)..)))).)))))))))((((((((((.....((.((((((((.....)))..))))))).....))))))))))(((...((((.......))))..))).........((((((((((...................)))))))))))))))).)))))))))).(((((((.(((((.((((((...((.((((...)))).))..)))))).........(((......))))))))..))))))))))))))...)))))))...)).))))))))....))))..))))))))...)))))).........((((......))))...))))....)..)))).)))))))).)..))))))).....(((((((....(((((.....)))))..)))))))))))))))))))))))))).)))).))))).......((((((.........................))))))........(((((......))))).))).))).))))..))))))))))))))))))))).....))))....)))..))..))))))...))))))).))).))))))(((((...))))).(((..(((((..((((....))))..)))))))))))))))))))......))))..)))))))..).)))))))))))...)))))))...............))))))).(((.(((.....))).))))).)))).))...)).))))).)).)))......))))))..))..((((.......)))).))))))......(((((((..(((((..(((....(((.........))).....)))..))))).)))))))..((((.(((..(((.(.....((((........))))..).)))..))).)))))))))..))).))..))))).)))((((((.(((......((((((((.(((.........))).))))))))((((.....(((.((((((..((((....))))..)))))).)))....))))..(((......))))))))))))))...)))))))))).))))))))))..)))...(((.(((((.....))))).)))((((((.((((((((((((((...((((........))))......(((.....(((.(((........))).))).....)))...........(((......)))...))))))((((...))))))))))))))))))..))))))))))...).))))))).)).((((((....))))))(((((((..........)))))))))).....)))))))))).)))).....)))).))).))))...))))....).)))).)..))))))))).(((((.....)))))..((....)))))))(((((..((((((((((((((((.((((..(((((((..(((..((((......))))..)))....)))))))..))))..(((((((((((........)))))....))))))((((((...(((((((((((((...)))).)))))))))..))))))...((((((.........))))))(((((.......(((((..(((((.....((((...(((.............)))....))))......)))))..))))).......)))))((((((((......))))))))..............)))))))))))))))).((((....)))).....((((..(((((((((((((((...)))))).))))....))))).))))..)))))
Thermodynamic Ensemble Prediction
((((({((({(({,((({,,,.}|}}.}.))))))),(((((((((...{.((((.(((((((((.(((.(((({,,.(((((((.(((({((..{,({{...|},|,,||||}}}.})))))),{((.((((((({(({..|...,,.)))..)))).....}))).))}.((((((((((((((.....(((,,((((((((.({,.((((((((.((((((((((....)))))))))).)......))))))).))))....)))))),{,,({...{{{{.||||,.((((((.,.(((((((((...(((((((.........((((.(((.(((((......((((.(((...)))))))...{(((((((({,,.,....{(((.((((((((((,.(((((((((..{,,(((,{,,(({{{{((((((((.(((((({....(((((.{({((,((..,,((,,....|,)).}}..}}.}}}},{{{.((((((((((..(((((((((((.((((((((((((,(((,,,||}}..((((.,{({{.,,|,,}},,....}}},((((.((((((((((((.......))).)).((((({{(((((..(((((..,.........,,...))))).......,.(((((....))))).,)))))))))))..,(((((...,...(((((((.{{{......})))))))))........))))).,{{.....}})))))))))))...((((((.({{((({...,(((({(({({((.,,..,,{({..,((((.((.........)).)))}...|,,..,|||.|{{.{{{{,...,|}}}},}|.,..,)))),})),)))}||,|{}|||}{(((((.{{.(({...))))).)))))),},,,..,..,,..,...}))})))))))))))).)))))))))},)).))).).)))).))).)))))))))).}}}...,....)}})).,.(((((((((...))).).)))))((((((((((((...))))))}})))))........,.......,,}},...}))))))..)))}})))},,,,|.,......},},,...))))),..,)))))))))}.,,{(((({.,(((.....,}}.|||||.....{{|{{,,..||,}}|}),..,}}|||.|,.,{{....,,,}|.,}||,,.,,|}}|||{{{...,}})}.}},}})),..}))))).).)))))))))).)))|{{||{|||{{|,|,,.,}}.....})).,}}}}}))))))))}....,......(({{((((((.((.((.(((((((....,,.{((..{((((((,,,.....((((((.{{((({...})))....,}))))))....}}}})}),,))),|((({...})))}))))))).))))........(((((....)))))((((.(((((((..((..((....{((,.....)))))..))..))))))))))).{((........))}((........},....))))))))),(({((.{(((({..((((,,,{{{||,||.||||{||||,,...,||||}}}})))))))...........(((.((.(((((((((......))))))))))).)))......})))..})),,)).))))}.(((((.((((((((((((.{{{,.........((((((((.((.......((((((((.{,...,})))).)))).((((((....))))))......)))))))))).,((((((((.((((.....)).)).))))......,.(((((.((((((((..,((..((((((..{(((((((((.((((((((({.,,,{(,..,,{{,,|{,,|||.|((|.,,,||||,}})}})))),..|,|,{||||..,,,{{{{,{{......{|||{{{{|,{.((({(((((({{....}).)))))}..,,,..})))},,.,},}),)}})),..))))))).)))...))..}))))))).{{{....))).(((((((....,,....,,......)))))))....))))))..))))))))))))))).,,.))))|,....,}))....)))))))))))).)))))..((((((.({.......}})))))).((((.((((((,...,)))))))))))))))))).))))..........))))))).....))))))).))....{{{.{((.{((((((((((,((((......}}}}.||}}...}})))))).))).))),||||}},|}))}{{{{.(((..((((((((((.((.((((((((.,,(((((((((...))))))).((((.(((....))).))))......((((((((...(((((.(((((...{(((((..({..((((((.(((.((.(((((.((((.(((((((((({(((((((((((((,{((((((.(..((((.(((.((((..((.(((((((((((((((.(((.{{{..(((....)))((((((...((((.((({{((((((((((,.....|,,.((((.,..((((.((((((.(((((((({...}))).))))).)))))).)).)),,..,)))),)))))))))))))..))))))))))....(((((,(((,.{((({(((((((.(((((((.(((.({.....((((((((((((.(,,{((,,.((((..((((..{,({{..(((((((((((({,((.((.((((.((((.(({(({...,....,,.{((((.((....,,),.)))))|}|{(({{(((..((((((.(((....))).))))))..))))}}..|||,,.})))).)).)))))))).)).))))))))).)))))),,)}}))))....)))),))))},))))))))))))......)}))).)))}}))).)))))||{....,,|}|(((((...}))))|{|,||{{{|{((((...{{..{(((((((||....,}}.....((((...)))).)))))))}.,||.....,,{,,|}}}}}))))}.}})|||{...,{(({|{{{{((((.(((((((.(((.(((((((((((((((((..(((.,,.{{(((((,(((((((({..(((.((.(((((...)))))))))).(((((({..{((({.............))))))))))){{(,{{(({{.,({((((,,(((((,(((.{,{{{{{{{(({...{{{{{{{}}..,,,,,}}},,}))))}))))))})))|,.||||,,}}}}}}}))),)))),,,|}))).(((((,((((.....(((((((((({(.(.((((...{(.|..{(..((((((((....,..{((((((((((.{(((((((((((((((.(((({.{(({{{(((..((((((((.((....))..)))))))))))).,{(((((({((((((((((.{{..,...(((.((((((...)))))).)))...,}}}}||{{({((,(((((({((((((......))))))}|||||.},..((((((((......))))))))......((((((({{({,{{{,.,},,||||,((((....))))..{||||{,....,))))))}}}}})))))),{{..,,}}}.}))))))..((((.(((.((((........}|.)).))))))){((((((((((((..(((.,{{((((((,,,....,((((.....}}||,.,.,..}))}}}}}}}},......{{,..{{{,....,})),))).,..)))))))))))))))}})}}.|}}|......(((((((..{((({{((..,{((((((((({.........)))))))))}}|{{({.{{{(((,,({((((({{.{{..{(({(((.,.{{{.{(((({.{{{{||,,.,...{{,,..{(((((...(((.,.{.(((((((......(((((((((((..(((..(((((,,,...{{((,...}|}|{{((((((.{((((((({...))))))))}||{,,....,.))}{{..((((((((.,{((({...)}))))))))))..}}....))))))....,,,,((((,.,.,}}.(((((((((((((((((......,))}))}})))))))))))}}}}}}}|},|||{...,,,}{{|||.,....)))))...))))).))).))))))))))).(((((.......)))))..((((.{..((((((((((((({{{{((((.....(((((..((({{.(({.(((((,,((..(((.((((,{{,(((({{{(((((((((((((,,(((..{(((((({,,..((((({.(({({{{(||||((((((....))))))....(((((.((((((((.((,{(((...((((......)))).))))))))).....{(((....))))....))))).))))),{((({{{.{{{{{.,|||..,,,{{{{{({.{{{{{{{|||{|.,||}}..})))).))))))))|{{.((((((..(((.((((((....))))))((((((((..(((((({..((((((((.((((......,)))).)))))))){(((.{((({,,,{({,.{(({((((({(((,.,,.{((((,((((...(((..,,(((((,((((({...((((({..(((.(({((((.(((((({{{....{((({,....((((((..,{,........},,.))))))..{((({....))))}..}}}}),,,,,))))..)))).....}}})))}),})))...}.))))).))))).,.)))..........{|||,||||,...)))),})))|||,....}},((((.(((......((.(((((((((...((((((......{{{(,,,,|}},,((.((.(((.......))).)).)},...,,,}}}.{(((....))))......))))))...))))))))).))....))).)))),}))),)))..,))|,||.}}}..|}}}}}}}}}.})).....}}}}))))).........))))))).))))))))..{(((((.{(.,{,...{{{.((((.(((..((({{.{{{.........)))..}}}}}.,)}).}}}}.,}))....,..)).)))))}......})).)))}))))),))))))))).)))))}....}.}))))))}}))).)))).))).)))))|{,.{(({{|||,..,.,(((((...,......))))){(((({(((((..,(({..(((((({(.((((((.((((.....(((.(((((((((..........,(((....)))|{((({{{((((........)))},}}}.)}.))}(((((((.(((((((..(((((.....(((.((((((.....)))))).)))((((((..........((((((...((((.......))))...)))))).,.)))))).........(((.{...(((((.(((.((.(.((((((.((....)).)))))).).))))).))))).}.)))}))))..)))).))).)))))))))))}..})))))).....)))).)))))},,,.,(((((((((((.((..((((.......((((..(((((((....)))),.}))..))))...,.))))..)).))).)))),}))){{,,{.{,,.,||}}}}},.(((({{{,,,,|,},)))}.}}}}}))))}.})},|||||||.,.,((({...})))}{|.....((({(((.{,..({((({,{({.{{|(,{(((..{{{.{({,.{{.............,,{{(,{((({{.{|,,..)),))}})})),))))},,.,)),,,}..,..(((({,,(((({,|||......))..})))))}))))}},.))))}}......,...,,|((.(((.(((({{...,.))))})}.})).})).,))))}))}}})}}))}}}))|)))))))..)))))))).}.}}}}.)))..)))))))))))}..))),,)))))))))..}...)))).)),,)))).},..))))))))}((((.(((((((.{{{{,.{,{(((((.......((((((((((((((((((..{,....})..)))))......(((.((.((.(((((((((((((((((.,.....,,,{{,........|||.,,..,,}..(((((((,......||.((((......)))).{{.((.((((....)))).)).))...}))))))....),})))))))))))))).)).)).)))...(((((((.....))))))).((((((((.(((.......,{{(({,..(((((.{.(((...(((((.{..........}.))))).,.))),.)))))))))))))..))))))))((((((((...))))))))....))))}}))))))))))))))}||,||.,.,.))))))))))).((({,.({((((..(((....)))..)))}})).,.)))}.,}},..}}}}.,}}.)))))}}}}..((({(.{{{(({{,....,{{..,(((,,,((({((,....}))))}}|||,.......,,,..,}},..,,)})))))|,|},|||,}}}}}}}...)),))}))))})})).))))))))}.))).)}}},...)))))))))))),.((((((((..{{{,....((((((....))))))....,,,}....})))))))..((((((((((({{,.{((|(((,||{{(({{((((,,,,...||}||}}}}}}.{||||{{||,|.{||{.,,..)))).}.}}})))))))},.))|,{||||{(.......,...............,...,,..,,||,............})))))}))))))))))....,,,,},,..,.....}},,)))))))))).))))))))))}.......,,..((((((...)))))}...))))))))))}.,|.,..((((((.,,{(,(((((((((((....((({,((((.,.....,.))))))))...)))))))..))}.)),}),..))))))..,.,,......,....,...(((((({(.(((((((..(((.(((.((((((.,,(((((((.(.(((.......))}.).))))))).,,....)))))).))).))),{{,...((((....)))).....}}}.(((((((.((....,...(((((....)))))..{,.(((((..(((((((,,......,,...))))))).))))).}),,,..)).)))))))))))))).)}.))..))))...||.(((...........))).})....,,},|{{,{(({(..,{{...}}}))))).},,.{((((.,{.(((.(((({,((((..((((((.((((....)))).)))))).(((((((.(((((...((((.{....}.)))),))))).)))))))))))))))).)))}.))))}))))))))..)).}.)).)))}.|,}}.))).))))))}(((.....)))}))).)))))))))))))).,,))))))),,,)).}..}.)))))))}))}}}{{{{.{{|||||.,.....,,,)}.))),||}}{{(,,({{{,.{{|,||,{|||.......((((((((((((.,{...........,.,}.))))))))))))}},,.({{{({{{(.{(((((((,,.....((((((...{,.((({...}))).,),.))))))..,{{(({(((.....,,|||,,{{|,,.,,}},,||,}|}},..})},,,}|.||||||||}},},,,..})}}}}}))}}|{{{,||,,|((({,.({{((((({..{{,(||((,,...,,,||),.}}}}..|||||,},.,))))},,))}}))))),||,,)))},,}}}}},))))))))))))))))...))))))))),)))))}}.})),}))}}..)}}.{{((({,.........,..........,,..)))))}........(((((......)))))..,,.}}}))))))..))).))))..)))),,}}}.,,,}}}||,||,,.})),))..})))}).)))))))),.))).))))))(((((...))))).(({..(((((..((((....))))..)))))})))))))))))))......))))..)))))))..).))))))))))),..})))))),,.............})))))}.{((.(((.....))).)))))})})).))...}).))))).)).)))......)))))),}))}|||,{...,,,,}}|,.}}}||}..,..,{((((((..(((({.,(({...,(((.........)}}.....}}),,))))).)))))))..((((.(((..,(({(.....||||.....,,.}}}}..,.))),.))).)))))))))..))).))..))))).)))(((((,,(((.....{((((((((.(((.......,.))).))))))))|{((,....(((.((((((..((((....))))..)))))).)))....))))..(((......))))))))))))))...)))))))))).))))))))))..)))...(((.(((((.....))))).))),(((((.((((((((((((((.,{(({(,......,||}}....,,||{.....|||,||{,{,,,...}}}.}}}.....))),},........(((......)))...}}}})}||||....,}))))))))))))))}..)))}))))))...|,||||}}}.},.((((((....)))))){((((((..........)))))))))).....))))))))))},)))....,)))).))).))))...))))....).)))).}..))))))))).(((((.....))))),,||.,,,))))))),{(((,.((((((((((((((((.((((..(((((((..{((,.{(((,.....))))..)))....)))))))..))))..(((((((((((........))))}...,))))))((((((.,.(((((((((((((...)))).))))))))).,))))))...((((((.........))))))(((((..,..{.(((((.,(({((.....{{{{...|||.............}}}....))))......)))))..})))).,.....))))){(((((({......}))))))}..............)))))))))))))))).((((....)))).....{(((..(((((((((((((({...}))))).)))}...,))))).)))),.)))),

Transcripts

ID Sequence Length GC content
GGACUCGCGUCCCGUGGAGCGUUCCAGGCGGGCGCGCGGCUUUCUCCCC… 9642 nt 0.5080
Summary

This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]

Forensic Context

A study in mice demonstrated that the LAMA1 was overexpressed in the ventral midbrain of a line selectively bred for low voluntary methamphetamine intake compared to a high-intake line, identifying it as a hub node among differentially expressed genes in the green coexpression module [Hitzemann et al. DOI:10.3390/brainsci9070155]. In human skin, analysis of thermally injured tissue showed the LAMA1 was significantly upregulated as a cell adhesion gene during the early wound repair process following burn injury [Greco et al. DOI:10.1016/j.burns.2009.06.211].