Basic Information

Symbol
LAMA5
RNA class
mRNA
Alias
Laminin Subunit Alpha 5 Laminin-10 Subunit Alpha Laminin-11 Subunit Alpha Laminin-15 Subunit Alpha Laminin Subunit Alpha-5 Laminin Alpha5-Chain Laminin Alpha-5 Chain Laminin, Alpha 5 KIAA0533 KIAA1907 NPHS26 BBDS2
Location (GRCh38)
20:62307955-62367312
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Tissue/body fluid identification Mixture deconvolution Drug abuse diagnoses
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_005560.6
Sequence length
11426.0 nt
GC content
0.6644

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-5421.70 kcal/mol
Thermodynamic ensemble
Free energy: -5602.31 kcal/mol
Frequency: 0.0000
Diversity: 2935.37
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((...((((((((.((.(((.(((((((.....)))))))))))).)))...)))))...))))).((((((...((((((((.(((....(((((...(((((((((.(((((((((((.((((.((((((.(((((.((.(((((((((.((((((.(((((((((.((.(((((.(((((((...(((((...((((((((((......((((((.(((((.((((..((((...((((((.....)))))).(((((((.(((.((((((....))))))....))).)).)))))..((((.((((((((((((.((.((((((((((((.(((....((((.((...((((((.(((..((.(((.(((((...((((....)))).........((((..(((..(..(((((....)))))..)..))).))))))))))))))..))))))))).)).))))..(((((.(((((((((........((((.(((((((.((.....)).))))))).)))).......))).((.((((((....((((((.((((.(((.(((((.((((((..........)))))).....))))))))(((((....))))).......((((((((((((((((((((((..((((((....((((((((((....((.(((((((.(((......(((........)))....))).)))).))).))(((...((((((((((((((((((...((......))....)))))))))).))))))))..)))((.(((((......(((((((...((((......(((((..(((((.....)))))........((((.(.(((.((((...)))).))).).))))((((....))))....((..(((....))).)).....((......((((((.((((..((((((..((....)).))))))..)))).))))))......))...))))).......(((((((..((((((((.............((.((((((.(.((....)).).)))))).)).......((((((...(((((((((.((..(((.((((((((..((.(((((.((((.(((((.(...(((........))).).)))))....(((....))))))).))))))).((((.((((...)))).)))).........(((((((((((..(((.....)))..))))).).))))))))....)))))(((((..(((.....)))......))))).............((((...(((..((((((...(((((((((....))..(((((......)))))((((...(((..(((((...)))))..)))...))))..((((.......)))).))))))).)))))).))).))))))).)).)))))))))...))))))........((((.(((.......)))...)))).)))))))))).))))))))).....)))))))......)))))))(((((((......((((..(((.((((..(((((((..((((..(.(((.....))))..)))).........(((.(.((..(....)..)).).))).))))))).))))...)))))))..))))))).))))))))))......))))))...))))))).....((((...)))))))).))))(((..((((((.(.....((((((.(((.((....)))))))))))).)))))).))).)))))))..((((......))))((((((((((((((...)))))...)))))))))..))))))))))(((((....).)))).)))))).))..)))))).)))))...)))))))))..))))))...))...))))..))))).))).))))...))))....))))..))))))).))))....)))))))))))))))...))))))))))))))((((...((((((((((((((((((..((..((((((((((((((((((.....))))))...(((((((((((((((((......((((.((((.(((((((((.((...(((.((.((((((...)))))).)).))).)).)).)))))))((((((.....((((((.(((((((((....(((((((..((((..(((((.(((((((.((((.((((((..((((.(((.(((.((((.((((...))))..)))).))))))...).)))((((((.(.((((((((((((((((((((.((((((...(.(((((((((((......)))))).))))).).(((.....)))..))))))......(((((((((.(((.((((((.(((((.((((((..(((((...)))))..))))))..)).))).))))(((.(((((((((((((...((((..((((((.....))))))....))))))))))........)))))))))).((((((((((...))))))))))...((((((.((((...........((((((.((.((((.((((..((((.........))))..)))).))))))...(((.((((........)))).)))...((((...((((((((((.(((((.(((((((((((.....(.((((.(((.((.....((((((((((...((((((.((((.((.....)))))).)))))).(((((((((..(((......((((.(((((.....(((((((((((....((((((((((.(((((...((((((....((((..........)))))))))).))).)).)).))).)))))(((((((...((..((((((((.....)))))).))..)).....))))))).))))))..)))))........((((((((((...((.....((.(((.(((((...)))))..))).)))).))))))))))...)))))...))))))))))))))))))))))))))))))).)))).)....((((((..(((.((...))))).)))))).)))))).))))).))))).)))))).)..)))..))))....))))))))))))))))..(((((((((((...((((((................(((((.(((((.......))))))))))..))))))....)))))))).)))..(((((.(((((((((((((...((((.((......)))))).)).........((..(((.((((((((((((((((((((((((((((.....(((((..(((((((((..((((((..........(((((.....)))))((((((((..((((..(((((((((((((((((((((.....(((((.((((....(((((((((.(((.......))))))))).)))....)).)))))))(((((......)))))((((.(((((....))))).)))).(((....)))...((.((((((((((.(((.((..(((.....)))............((((((((((((.(((((((((..((((((.....((((((.((((...)))).))))))..(((((....)))))...((((.((((((.......(((((.((......))....)))))..)))))).))))...........))))))))).).)))))))))))))).))).....(((((...(((....((((((((((......(((..((((.((((.(((((((...(((....)))....)))..)))).))))..))..)).))).....))))).))))))))...)))))...(((((....)))))...)).))))))))).)))).))..((......)))))))))))))......)))))))......)))..))))..))))))))....).))))))).)))))))..)))))(((...((((.............))))...)))...(((((((....)).)))))(((((...))))))))))))))...)))))......)))))))..))))))).)))..)))))))))).)))...))))).........)).))))))))))))...))).))))).)))))).)))))).)..)))))).......((((((.((.((....((((((..((.((((((((((((........)))))..((((..((....))..))))......(((((((((....((((((..............((((((......((((((.(((........)))))))))(((((((.(.(((.(((((((((.((((((((.....((((((.(((......))).))))...))...))))).))).)))))..(((((((.........(((((((((((((.((.((((((((((((..((..((..(((((((.((.(.((.((((.(((((..((....(((.((((((.((((((((((.(((((.....((((((((((((....(((((((((((.(((.(.(.(((..((((((.(((...(((((...(((((((((((.......))))))(((((.(.(((.(((((.((.((.........)).))))))).))).))))))...(((((((((((((.......(((..((((((((((((((..(((((...))))).)))))((...)).(((((((.(((((((...(((.(..(((((((((.(((((.(.....).)))))(((((((((.((((.(((((((((((((((..........(((......)))..))).))))))))....))))..)).)))))))))))....)))))))))))))...)))..)))).)))))))((((((((...((((((((.(((.((((((((.(((((.(((....)))))))).)....))))))).))).(.((((((...)))))).)((.(((..((((((.(((...)))))))))..))))).((((...((((((..((..((((((..(((((.....)))))...))).)))..)))))))))))))))))))))))))))).............)))))))).)..)))......)))..))))))))))((((((((((((((.((((....))...))))))))))).))).)).((((((.........))).)))((((.....))))(((((..((((((((((.(((((...(((((.....)))))..((((.......((((((((.....((((((((.......((((((((((..(((((.(((......)))......(((((((..((((((((.(((....(((.((((.((((((((((...(((((.((...)).))))).(((((.(.(((((((........)))).))).).)))))........(((((((.((.............)).)))))))........((((((.((..(((((......)))))..))))))))...))))))))))...(((.(((((.((((((.....)))...)))))))).)))..)))))))....)))))).)))))....))))))).))))))))))))))))))))))).)).))))))......))))))))).))))))))))..))))).((((...((........))....((((..(((((...)))))))))(((((((((((...))))...((((.(((..(((.((((((.....)))))))))))).))))((((((...))))))...((((.(((((((((((((((((((.((((((......(((((((...(((((........(((((....)))))..(((.(((......)))))).....(((((.......)))))..)))))....)))))))((((((.(((((((((((..(((((((..(((((.((((((((.(...(((((..(((((....)))))......(((.(((..((((((..........)))))).))))))))))).).)))))).).).)))))..))))))...)..))).)).))).)))...)))))).)))))))))))))))...))))).))))).))))...))))))))))))))))..)))))...))).))))))))).).)))).)))))))))))....(((....)))(((((((..(((.((....((((...(((((((((..((((..((((((((.((((.((.((((((((((((.(((.(((.(((......))).))).))....).))))))))))...)).)).)))))))).....((((((.((((......((((((((((..(((((((((((..((((((.(((...((((....))))...((((((...)))))).(((((.((((((.(..(((..((((....))))...)))..).)))))).)))))......(((((....))))))))...))))))))))))))))).)))))).....)))).....))))..)))))))))).)))).)))))))))..))))...)))))..).)))))).))))))))))))))))).))))))).)))......)))))).))).))..))))).))))..))).)))))))))....))..)).))))).((((.....)))).))))))).)).))))..))))).)))).....((.(((.((((((.....)))))).))).))....((((....)))).)))))))..)))))))))))))))(((....)))..)))))).......(((((((((((((..((.((.....))))))))))))))))).))))))(((((((((.........))).))))))))))))))))).))))).)))))))).)))).)).))))))))))..))))))))))))))))..)))).....))).))))....))))))))).))))))....))).)))((((((((........))))))))(((.((.(((.....))))).))).((..(((((((((..((((((((.(((((.((.(((((.((((((((.((..(.((((((((((((((((((((.......))))).))).))).(((.........)))(((((......)))))...((((((((...)))))))).(((.((((((.((.((.(..((((((...))))))..).)).)))))))))))..((((.(((((.(((.(((((......)))))...(((((.....))))).(((((((((.((.(((((((..((.((((....((((((((..(((((((((.((......)))))))).(((((.((.......)))))))....((((((.......))))))...((((.....))))....))).))))))))))))...((((.(((((((((((.((.....))))))..))))))).))))((((((((((((......((.(((((.(((.....)))))))).))))))))))))))((.((.(((((.((.(.((((((.....((((..((.((.....))))..)))))))))).).)).).)))).))))....))..))))))).)).))).(((.((((.............)))).)))..)))))).)))))))).))))....)))))))(((....))).((((((.(.((........)).).))))))..............)))..)).)))))))).)).))))).)).....))).))))))))..))))..))))).))...))))))))...))))))))))))))))).......)))))))...)))))))...)))))..))))))))))))).....)))).))).))))))...((.....)).)))))))))))).((((((...(.((.(((((((((....))..))))))).)).)))))))..))))).))))))))))).)))).))))).).(.((.....)).).))))).)))))))))((((((((((..(((((((.(((...)))..)))))))..(((((((......)))))))..((.......)))))))))))).....((((((((((((((((..(((((((((((...((((.(.((..(((.((.((((.((...((((((((.(((((...(.(((.(((((((....))))........))).))).)...))))).))))...))))..)).))))..)).))))).).)))))))))))))))...............))))).)))))).)))))..(((((((.(((((((((((...(((((((.(.((((.........)))).).))))))).....)).)))))).......((((..((.(((((((((((((((((((((((((.....((((((...(((((....)))))....)).))))((((((....)))))).........((((((((((((((.(((((.((....((((((((....((((((.((.(.((((.(((((((.((...(((((.....(((((.((((((....((((((....))))))((((((((....((.((((.((......)).)))).))(((((...)))))..(((((((.(.((.(((((...(((...))).......(((.(..(((..(((..((((((.((..((.......(((.((((....)))).)))......))))))))))..)))..)))..).))).(((((((...))).)))).))))).)).).))).))))((((((....))))))...((((((.(((((.....)))))))))))....(((((((..((((.(((.(....).)))...)))).....((((.(((((.(((((((((((.(((.(((.(((((((.(((.((.((.(((.(..((((.....(((((((((.((...((...((((((((((((((((((.(((.(((((((((((...)))))((((((((((....((((((.((..((.......))..)).)))))).....))))))).)))...(((((((.((((((((((..((.((((((........(((((((..((...(((((((((....))).)).))))(((.((((((((((..(.((((((..........((((.(((.......))))))).........)))))).)..))))))))))..))).....))..))))))))))))))))))))))(((..(((((((((...((((.(((((.(((....)))..))))).)))).....).))))))))..)))((((((...(((..((((..............))))))))))))).)))..)))))))........(((.((........)).))))).)))))))..))).....))))..).))))))))))...))....))....(((((......))))).))))))..))).....((((((((.....))))))))..((((((((((((.......))).(((((.........))))).(((....)))..((((...(((((.(((....(((..((((((.(((..(((((((((..(((...))).)))).))))).......))).))))))..))))))))))).....)))).((((((..(((((((..........))))).)))))))).)))))))))))))..)))))).)).))))))))))..))).)))..))))))))).))...))))).))))..(((((......)))))))))))).))))))))((((..(((((....(((((.(((((........)))))....)))))....))))))).))))))))...))))).....))))))))))))))))))))).))))))........))))))))((((.(((..(((..(((.(((((((.....))))))).)))..)))..)))..))))(((((((((((((.(.((((((((((((...((.....)).)))))))....)).))).).))))..))))....(((((......)))))...((..(((((((((((((((..(((((((((((((((((..(((..((((((((.((((((..(((.((((((((.......)))))..(((((((((....((((((.((((((((.((..(((.(((((....)).))).)))..)).))..))).))).)))))).)))))))))((.((((((((......(((((.(((((......)))))))))).)))))))).)).))))))..)))))).))).(((..((((((.(((.........)))))))).)..))).(((........)))..)))))..)))..))))))))))))(((((((....))))).)).....))))).))))))))))..)))))))(((((((....))))))).))))).((((.....)))))).)).))).).))))))))))))).....(((....))).(((((...(((..(((((....(((((.((...)).))))))))))..)))...))))).....((.(((((((.((((((..((.....))..)))).((((.(((.....))).)))))).))))))).))..)))))))))))..))))))))))).))))).))))..(((.(.(((((((((((((((.(((......))).(((((.((.((((((.......)))))).))))).))....(((.(((((((((....))))))))))))))))))))).)))))).).)))((((..(((.(((((......)))...)))))))))..))))))))))..)))))))).))))))))..)))...((((.((((....)))))))).))).....(((((((((((((.....(((((((((....(((......(((((......)))))......)))((.((((((....)))))).))........))))))))).......)))))))))))))......(((.((((.((..((((...))))..)).))))...)))...
Thermodynamic Ensemble Prediction
..,..{(((({,((((((((({{(,(((,(((((((,...,)))))))}||||,||}.{{|||},.{.|||||..({(((.,.({((((((,((({,..{||||,,,{{((((({{.||||||{{|||,|{|{,{{||{{,||{{|,|({((({{{{||,||||||}|{|||||||,|{.((({(((((((((...(((((...((((((((((......((((((.(((((.(((,....(((.{((((((,...,)))))).}|.})}..,((.((((((....)))))).},.|(((((..|.....((((.((((((((((((.((.((((((((((((,{((....((((.((...(((((,{(((..((.(((.(((((...((((,...}})).....,,,.((((..(((..(..(((((....)))))..)..))).))))))))))))))..))))))))).)).)))).,(((((.((((((,{{........((((.(((((((.((.....)).))))))).)))).......}},.((.((((((....((((((.((((.(((.(((((.((((((.,......,.)))))).....))))))))(((((....})))).......((((((,..{{,,((((((((,.{((((.{{{,,((,(((((((.,,,{{.{(((((,.(((({...,{{,......,.||{{,{,|||,,|||{|||.||(((...((((((((((((((({(({.((({......)}.}}))))))))))},)))))))..}))||||,|||..,}}}|||,|,,...||{|.,...||||||,,|{{((.....)))),......,|,{(((({,(({(((({.{||},.|||(({({((({((....)))|.}}}||.|(((....},}.}}.....,|.,....((((((.((((..((((((..((....)).))))))..)))).))))))....,,}}...,)),}|||,.,,(((((((({((.(((({.{{,.......})}}}||{|||,,}||,..{||.|{|}||}|{{|,.,.....|{||}}}.||.||||||}}{,,|||..}}))}}}..(({(((.(((((..(({...{{..,{||..,},,...))))),)))}.}}.}}}}}}))))).}}))|||||.((((.((((...)))).)))).,......,((((((((((,{{(({.....})},}))))).).)))))}})}}}...,}}|||||}}{||.},..)))},..}}))))),.....,,.)))))}.||{,,{|..,,,|{|,|||(((((.{({{{{{|||(((((......))))}(((({{{({(.((.(({{.,((((((..((....}}||||||..,,,||||||||,||||||{,|}}||.|.|,{((((((.||.||((||,,,...},,}},.,,,)}.))))))),|,.,|..,,}},}),|||||||||,|{{{.{||{{||||.,.{{|||||||.{{...},,|||{{((((((..{{{{((,...((({,,,({{((.,,,,..((((..(.(((.....))))..))))..}}))}.}))).}}}..}}.}.,)))))))))))},))))),})))).},))))),)))))))))}.,}})))),}),}}}}})}))))}..,.||))|.}}}}||{|.,,|}}}}}.,))))))}})}{(({{{,{.....(((((,,(((.({....)}))))))))))}))}}}},},,.}}}},)),.|{||,,,,,,)))){(((((((((((((...)))))...))))))))}..))))))))))(((({....),}))).)))))).))..)))))).))))).,.)))))))))..))))))...))...))))..))))),,)).))))...,.}..)))))))).))))))).))))....))))))))))))))).,.))))))))))))))|||(.,.((((((((((((((((((..{{..((((((((((((((((((.....)))))),..(((((((((((((((((...,..(({{{((((.(((((((((.((...(((.((.((((((...}))))).)),))).)).))))))))))|{{({{...,.((((((.(((((((((....(((((((.,((((..((((,{(((((({,((((.((((((..((({.(((.(((.((((.((({...))))..)))).))))))...).)))((((((.(.(((((((((((((((((({{.((((((..,{.(((((((((((......)))))).))))).,.||(.....}}}.,)))))).|||..(((((((((.(((.((((((.{((((.((((((..(((((...)))))..))))))..)))),),)))}||{,(((((((((((((...((((,.((((((.....)))))).,..)))))))))}........))))))}}||,{((((({(((.,.|}}|||||||||.({((({,{((({{{,...,,{.(({((({({.((((.((((..((((.........))))..)))).))))}}.}}{|(.((((........)))).}))...((((,{.{,,{((((((.(((((.(((((((((((...,{..,(((.({(.{{...,.((((((((({...((((((.((((.((,...,)))))).)))))).(((((((((..(((.,,.|,||{(,(((((...,.(((((((((({.|,,{{{{{(((((.(({{{.,.(((({{..,.{{{(..........}))})))))).))}.}).)).))),))}}|(((((((..,((..((((((((.....)))))).))..)).....)))))))}))})))..}))))...,,...((((((((((...((||...,{.(((.(((((...)))))..))),)})).))))))))))...}}))),,})}))))}))))))))))))))))))))}))),}})}}).,..((((((..(((.{{...))))).)))))).)))))).))))).))))).)))))).,..,))..))))....)))))))))|||}}})},{((((((((((...((((((................(((((.(((((.......))))))))))..))))))....)))))))))}}}..||{{{.|{{|||||||{||.,,{|||.||},,}|.)))))}.}||,,.|||..||..(((.{(((((((((((((((((((((((((((.....(((((..{||||(({{{.((((((,..{{,,,..{((((.....))))}((((((((..((((..(((((((((((((((((((((,,...({{{({((((,,,.{{(((((((.(((.......)))))))))).}|,,,,|}.},)))))|{|||},.,,})}})}((((.(((((....))))).)))).{((....))}...((,((((((((((.(((.,,..(((.....)))............((((((((((((.((((({(((..((((((.....((((((.((((...)))).))))))..(((((....)))))..((((((..(((....)))..))))))...{.,,(,....({((({....)))}))}..,,),......))))))))).}.)))))))))))))).))).,...((({|...(((....((((((((((......((({{(,.,.((((.(((((((...(((....)))....)))..)))).))))..}}.,),.))).....))))).))))))))...}))))...(((((....)))))...}),)))))))))))))),},..}|.....,).)))))))))))......)))))))...,,.)))..))))..))))))))....|||||}|||,|}}||||,,||}}}(({...{{(({{,...|,,....})))...))),,.(((((((....)).))))){{|||..,))))))))))))))...)))))......)))))))..))))))).)))..)}}))))}))}))).,.))))),....,,..}}}))))))))))))..,))).))))))}})))).)))))).)..))))))..{{,..,,|||,.((.,,....((((((..((.((((((((((((........))))){.((((..((....))..)))).,....(((((((((....((((((...,{,........|||(((((((...((((((((({{,..((.|,{{|,}}.((((({,.({(((.(((,.{((({{(({,(,{{{{{{({{,,({(,{,{.,,,{||{{{{|,|{(|,,{{|{{{{{{|,|||,,..,|(((({,,}|,},..,{{{(||||,|||.||,|||||{|{||{{,.||,..},}||}}|||||||{,||.,|||}|||{{..||....(((.((((((,((((((((((.(((((.....((((((((((((....(((((((((((.(((.(.(.(((..((((((.(((...(((((.,.(((((((((((.......))))))(((((.(.(((.(((((.((.((,......,.}}.}}))))).))).))))))...(((((((((((((.......(((..,(((((((((((((.,{((((...))))).))))){{...||.(((((((.(((((((...(((.{..(((((((((.(((((.(.....).)))))(((((((((.{{(,.{{(((((((((((((..........,||......}}}..)))}}})))))))}..}}}|,.,,.)))))))))))....)))))))))})))...)))..)))).)))))))((((((((...((((((((.(((.((((((({.(((((.(((....)))))))).,....))))))).))).(.((((((...)))))).){(.(((..((((((.(((...)))))))))..))))).{{((,..((((((.,((,.{(((({.,(((((.....)))))...))),))),.}})))))))))})))))))))))))))).............)))))))).}..)))...}..}))..))))))))))((((((((((((((.{,((....))...},))))))))))})),)).((((((.........))).))){(((.....)))|(((((..(((((((({(.(((((...,((((.....))))|{{(((,.....,}||||{{|,..||.((((((((.......(((((((((((,(((((.(((......)))......{((((((..((((((((.(((..,.(((.((((.((((((((((,({{((((,((,{{||.|||||,(((((.{,(((((((........)))).))).}.)))}),,,,,,..(((((((.((.,...........)).)))))))........((((((.((..(((((,.....)))))..))))))))...|))))))))},..(((.((((,,((((((.....)))...)))))))).)))..))))))).}..)))))),,))))....))))))),)))}))))))))))))))))))).||.|||,,,..}}}.))}}))))).))))))))))..)))))}{{{(..,{{|,,.,,...,..,.((((..{((((...))))))))){|{{{({({{{,,,|}|}...,(((.(((.,{({.{(((((.....)))))))))))).}))}((((({...,)))))...{{{{.(({((,{((((((((((({,((((((.{{...(((((((...(((((........(((((....)))))..(((.(((......))))))..,,.(((({.,.....)}}}}..}}})).,,.})))))){{((((,(({((((((((..{{(((((..(((((.((((((((.(...(((((..((({{..,,||}||,.....|||,|||..((((((..........)))))).)))))}))))).).)))))).}.).)))))..))))))...)..))).)).))},))}...))))))})))))))))))))))))}}}})}.))))).))))...)))))))))))))))),.)))))...))).))))))))).).)))).)))))))))))....(((....)))(((((((..(((.((....((((.,.(((((((((..((((..((((((((({(((.((.{{(((((((((((.((.(((.(((......))).))).))....))))))))))))...}}.)).)))||}}}.....((({{(,,,{(.||...((((((((((..(((((((((((..((((((.{((,..((((....)))).|,((((((...)))))).(((((.((((((.{..(((..((((....))))...)))..}.)))))).)))))...{,.(((((....))))))),...))))))))))))))))).)))))).....))))...,,)))).,))))))}))).)))).))))))))).,))))...)))))..).)))))).))))))))))))))))).))))))).)))...}..)))))).))).)),}))))).}}))}))))})))}))))),,},},...|,.(((,(((.....))),)))))),))),)))))))},))))).,|}|...,}||}|||}||||||}}..{||}|||{|,|{||....,,,)}}.}}}))}},}}}.))))))),{((((((({{(((....)))..))))))..,})))(((((((((((((,..{.((.....})))))))))))))))).)))))){((((((((.........))))))))))))))))))))).))))).)))))))).,}}}.}}.}},,))))))..))))))))))))))))..)))).....))).))))....))))))))).))))))...,))).,},((((((((,.....,.))))))))(((.((.(((.....))))}.))}.||,,{((((((((..((((((((.(((((.((.(((((.((((((((.(({((.,,,|||||.(({((((((((.......))))).))).))),|||......,..})){(((({....}))))|,((((((((((...)))))))).))|,((((((.((.((.(..((((((...))))))..).)).)))))))),((((.(,{(((.(((((((((((((((((.((,,.((((((..{{(((,{,,,..,|||||,,}}}}))|{||...,))))||,,.,((((((((..(((((((((.((......)))))))).(((((.((.......)))))))....((((((.......))))))..{((((.....)}))}}..))).)))))))).,,,...((((.(((((((((({{((.....)))))}..))))))).))))((((((((((((......((.(((((.(((.....)))))))).)))))))))))))))).)))))))).((((.{.(((.....))).,))))........{(.((((((...(((..((((....))))..))).)))))).))((((((((((((,({.((,({{.{{,.......))},})))}.....),)))..))))))).)).)))))))))))))))))),.((((((.(.((........)).).)))))).,......|,....|}...})})))))))).)),})))).)).....))).))))))))..))))..))))),))},.))))))))..,))))))))))))))))).......)))))))...)))))},...)))))..)))))))))))))..,,,||||,|||.||||||..,{{,,...,}.}||||}}}}})).({((((..,|,((.(((((((({....}}..))))))).}}.,}}))}},{|||}}.}}}}))))))}.)))),)})}|||,,.{(,,..,||{|.}||}|,|||||||}}((((((((((..(((((((.(({...})}..)))))))..(((((((......)))))))..{(,......)))))))))))).....{((((((((({(({{{.,{|{{|||||{{...{|||..{|||||||.|||||{{,|{.,|{{{,,|||}||,|,...|}||||||}||||}}{,||||||||,||.}}}}))}))}}}))})).,},|,..||||{{|}.,)))}})).}))}}}},}))))}}|}}}}}}|,,,....,.....,|})))).}}||||.}}}||..((((((({{{((((({,(({{.(((((((.(.((((.........)))).).))))))).....||.||||||....,,.((((..((.(((((((((((((((((((((((((.....,{{{{(((((((((....))))).....{.,(((((((((....)))))))).}},,..((((((((((((((.(((((.((...{((((((((.{(.((((((.((.{.((((.(((((((.({...(((((.....(((((.((((((....,{((((....))))||{((.{(((((..((((({(.(((((((((.((((((.((...))))).))).)))))......)))))))))).))))).}.))}},,..(((.(..(((..(((..((((((.((..{{{,,..{.(((.((((....)))).))).,...,))))))))))..)))..)))..).})).{,(((((((((((((.,,((({{(((.....,|||||,{(((((....)))))}...((((((.(((((.....)))))))))))..},{(((((({.((((.(((.(....).)))...))))...{.((((.(((((.(((((((((((.(((.(((.(((((((.(((.((.{.{(((((..((((,,...(((((((((.((...,{...((((((((((((((((,,{((..((..(((((((.((.{......}.)))))))))((((((.((..((.......}}..)).))))))..,((((((((((((..(((((..,..((((((((((..{{.((((((.....,,,(({(({,,,((...{{((,(((({{{,|||.||{{|||{,,.,|{|||||||}|{.((((((......}}}}||{,.(((.......)))))))})}}.,)..))))}),)))))}}}})}},..}}}.....}),,}}))))}))))))}})))))))(((..(((((((({...((((.(((((.(((....)))..))))).)))).....).))))))))..))){((({{...({(,.{(((,.,,....,.....))))}}}|||}}},}}}{{{||.,....))}}}..}..)))))..)).)))..))))))))}}}}.)),.))}}))))..).))))))))))...}}....})....(((((......))))).)))))),,})).,...((((((((.....))))))))..((((((((({{{...,,,,|||.{{{{{.........})))|,(({..,,)),.,({{{.|,{((((.(((....(((..((((((.(((,{(((((((((..(((...))).)))).))))).,,....))).))))))..))))))))))}.},..)))).((((((..(((((((.{....,}..))))).)))))))).)))))))))))))..))))),.)).)))))))))}..})).)))..))))))))).))...))))).)))).}{((((......)))))))))))},||,,(((((....)))))....,,||||,....}))),}.))))))))))))).,.,,,..,,,,.)}..))))))...))))).....)))))).)))))))))))})).)))))){.(((.(((.((((..((((.(((..(((..(((.(((((((.....))))))).)))..)))..)))..))))...))))))).)))},|{{{,((((({({,.,.|}}}}))}})))}}}....||{|,((,{|(((((|{({.,,..{{{,..,|..}}))},.)}}..(((((((((((((((..(((((((((((((((((..(((..((((((((.((((({{|(((.((((((((.......}))))),(((((((((....((((((.((((((({.((..(((.(((((....))}})).)))..)).))..))).))).)))))).)))))))))((.((((((((......((((,{(((((......)))))))))).)))))))).)).))|)))..)))))).))|{((((({,,((({(,,.,,......)),)))))....}},...}))))),....,,.)))))..)))..)))))))))))){{(((((....))))).,,.....))))).))))))))))..))))).}|{|||{|,,..)))))})})),,}.,|||.}}}})),})).)).))).).)))))))))))))...{{((((.((.(((........))).)).)))).)}.}|||,{{(({{{,((((.(((({{.,{...,((.{{,.,,,{{|||{}|}...}{|||,.||,,,..))..}))),||||.|||}....)))}))))))))))}})))}},.)))))))))))..))))))))))).))))).)))).|(((.(.(((((((((((((((.{({,..,|,}}}.}}|||||{.((({(({((....|,||||||})))}))}...{{{.(((((((((....)))))))))})}))))))))).)))))).).)))|)}}.}}}},,.(((......))).)))),})))))..,}))))))))..})))}}))})))})))),,}))}},|{||,|{{{....))))}}},.},},,..,(((((((((((((.....(((((((((,,,{((,......{{|||,,,,..}}}}|......|},{{.,(((((....)))))},))........))))))))).......)))))))))))))......,,,,||||.{{..{{{....,}}}..}}.,}},.,,))),..

Transcripts

ID Sequence Length GC content
NM_005560.6 NCBI
AGACCCGCCGGGCUCCCGCCGCGCGCGCUGUCCCUGGAGCUCGGGGACG… 11426 nt 0.6644
Summary

This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]

Forensic Context

A study in mice demonstrated that the LAMA5 was overexpressed in the ventral midbrain of the methamphetamine low drinking line and was identified as an extracellular matrix gene [Hitzemann et al. DOI:10.3390/brainsci9070155]. In human menstrual blood-derived mesenchymal stem cells from women with endometriosis, the LAMA5 was identified within a protein-protein interaction network associated with extracellular matrix organization [Penariol et al. DOI:10.3390/ijms231911515]. A study in rats demonstrated that the LAMA5 is a basement membrane component whose mRNA expression was down-regulated at 72 hours after a 5 psi blast exposure but showed increased expression with higher shock wave intensity [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001]. In human forensic science, the LAMA5 protein was identified as a discriminatory marker for seminal fluid, exhibiting a Gini impurity score of 0 by being present in all pure seminal fluid samples and in mixtures containing semen while being absent in mixtures without it, enabling accurate body fluid classification in complex forensic samples [Shehata et al. DOI:10.1016/j.fsigen.2025.103343].