Basic Information

Symbol
LAMB1
RNA class
mRNA
Alias
Laminin Subunit Beta 1 Laminin Subunit Beta-1 Laminin B1 Chain Laminin, Beta 1 CLM Cutis Laxa With Marfanoid Phenotype Laminin-10 Subunit Beta Laminin-12 Subunit Beta Laminin-1 Subunit Beta Laminin-2 Subunit Beta Laminin-6 Subunit Beta Laminin-8 Subunit Beta LIS5
Location (GRCh38)
7:107923715-108004434
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Other applications
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_002291.3
Sequence length
5650.0 nt
GC content
0.4940

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1822.10 kcal/mol
Thermodynamic ensemble
Free energy: -1934.70 kcal/mol
Frequency: 0.0000
Diversity: 1487.65
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((.(((.((.((((((.((........)).)))))).))..))).))..))))).(((((.....(((((((.(((..(((((..((..(((((........((((((....))))))((((((..((((((((((((((.(((((((((((((((...........))).((((((((...((((((..(.((((.((...)))))).).))).))))))))))).((((((((.(((.((((((..((....(((((((((((((((((...((((((((((..((.((((.((((.((((((.....))))))...(((.(((((............))))).))).........((((((((...(((((((.......((((..((((((((((..((...(((..((((((((.((((.((.((((..(((((((..((((.((((.....(((((.(....)))))).....)))).)))))))))))...((((....)))).(((((......)))))......((((......)))).......(((.....)))((((......)))).......(((.((((..(((((((.....((((((((.(((....)))..)))).(((.(((.(((((...)))))))).)))........((((((((......(((((.((((((...)))).)).))))).((((....(((((((.(((.((((((.((((((...))))).).))))))((((((...((....((((((....((((..(((((((((.(((.............((((.(((((((...))))))).))))..))).)).)))))))..)))).))))))))...))))))....((((..(((..((((....))))..))).)))).))).)))))))))))...(((((((((.((((...))))....((((..((((((((..(((..(((((..((((((((.((((((.((((..(.((.(((((.(((((((......((((((.........(((((.(((....))).))).)).........)))))).....(((((..........)))))..)))))))....)))))..)))..)))))))))).))......))))))..)))...))..).))...)))))))).)))).)))))))))(((((((.(((...))).))).))))))))))))(((.(((....))))))..............))))..)))))))..)))))))...)))).)).)))).))))..))))....)))))..)))..)).)))))..)))))))))))))))).)))(((((((((......(((((((........))))))))))))))))......)))).).))).((((((....)))))).))..))))))))))..((((((((((...(((((.((......))...))))).)))))).))))(((((((((...)))))))))((((((.....))))))....((((((.((((.((((((.(((.(((((.((((.......)))).)))))))).))((((....))))(((((.(((...((((.(((((((((((.(.(((((((...((((.((.(.(((((....(((....)))))))).).))))))((((.(.((....))))))))))))))..).)))))).((((..(...((((((..((((....(((.(((.(((((((.......(((((.......)))))..(((.......))))))))))..))).)))((((((((......(((((((..((....))))))))).....))).))))).(((((((((((....))))..)))))))(((.......))).....))))..)))))))..))))..))))).)))).)))..)))))((((((.((((.....))))....)))))).....)))))))).))))))(((((((..((......((((((((.(......)))))...((((((((((.((....))))))))))))....)))).......))..)))))))))))))))).......)))))))).......))....)))).)).)))))))))))(((..........))).))))))).)))))))))))(((((((.((.(.........((((.((.((((..((((...((.(((((((((....(..(((((((((((((...((.(((....)))..))...)))))...))))))))..).....))))))))).))...))))...(((((((....)).)))))...(((((((....))))))).......(((....)))((((((......))))))..)))).)).))))(((((((...))).))))...).)).))))))).(((....)))(((....))).))))))))(((((...))))).....))))))...........(((((((....((((.((((((..((((((((((..((((((((......)).))))))................))).))))....))))))))).))))....)))))))((((....)))).(((((...(((((((....((...(((((((((((..(......)..))))...)))))))...))...))))))).)))))((((((((((.(((((..((((..(((((((((((((....(((((.......)))))...))).)))))).)))).....)))).))))))))))))))).)))))..))..)))))...))))))))))......)))))(((.((((.((((((.((((((((((...(((((((...((((......))))))))...)))...))..)))))).)).))))))))))..))).......(((((.(((((((((((((((.(((.......((((((((((...((((.((.....((((((.(((((..((((((..((((..(((((...(((......)))...)))))...))))...(((((((.(.((....)).).)))..))))))))))..)).....)))))))))..)))))))))))))))).))).)))).)))))))...........))))))))).((((((((((((((((..((((((.(((((((((((......).)))))).))))((((((((((((((..(((((((((((....(((((((.((((((....((((((..((..((.(((((((...)))))))))..))((((((((((((((((((((((((((((...((..((((((.((...(((..((((((.(((....)))))))(((((((((((((..(((((.((((((((....((.(((((.((((((...)))))..).))))).))..((((((((((((.((......(((........))).....)).).)))).)))))))(((((((((((.(((...(((((.(((((((((.((((((.....(((..(((.((((.((((((((((((((((((((.....((((.((((((((.(...(.(((((((((((....)))).....(((...(..(((((.........)))))..)..))).(((((((....(((((......)))))))))))).))).)))))...).))).))))))).))..)))))).).))....)))).)))))....)).)))))))....(((((((((...((((((...((((((((((......))))))....))))...)))))).)))......)))))).....(((((................))))).....)))....))))))........))))))))).))........)))...))).))))).)))))).......)))))))).(((.(((((................((((((.(((((((........))))).)).))))))))))).)))(((((.......))))).)))))...)))))))......)))))).(((((((.((..((.(((.((((((((.((((((...........(((..((..(((((.......(((.(((.........((.(((((((......).))))))..))..(((.(((((..(((....)))(((((((.....(((((.((((......((((.((......))))))(((((((((((((....((....((.((((......))))...))......))......))))...))))))))))))).)))))))))))).....((((....))))))))).)))..(((((.((((((((((......)))).)))).)).)))))))).)))....))))).))..))))))))).)........))))))).)))...))....)).))))))).((.((((.((((...)))))))))).))...)))...)).).)))))))...)))))).)))).............((((((((..((((((((...))))).))).))))))))..)))))))...))))))))..)))..)))))).....((.(.(((...)))))))))))).)))))))((((((.((...........))..))))))((((((((((.......))))))).)))...((((...))))(((..(.((((((...(((((.((((((........(((.....)))..........))))))(((......))).)).)))...)))))).)..)))((((.......))))....)))).)))))))..)).))))))......))))))....(((....)))((((..(((((((.(((((...((((((...))).)))..))))).))))).))...))))((((..(((((.((..(((....))).........)).)))))...))))...(((.....))).(((........)))...((((.((((((((......)))))))).))))........((((((((..((....((((((.(((((((((((((((......))))..................................((((((((((.((.(.((((...((....))....((((.((...)).))))....(((((((....((((((....((..((.(((((((((......(((((..........(((......)))...................(((........)))..((.((((.(((....))).)))).))))))).......))).....)))))).)).....))...))))))....))))))).........))))).)).)).....(((......)))......................))))))))..........))))).)))))).))))))...))..))))))))))))))........))))))))))))))))...
Thermodynamic Ensemble Prediction
(((((((.(((.((.((((((.((........)).)))))).))..))).)},,))))){(((.....{((((((((.(((..(((((..(((((((,(((.(((((((.(((((((((((((..((((((((..((((.(((({{{{((((..((((({,...,},...,)))).))).).}))))))..})))..)))).,({{{....)}}|((({,(((((((.......)))))))..((((..((((((((,{(.(((.(,{.((({((,({{((((((....(((..((((((.({.((((((.....)))))).}).(((((((((((({(((.....((((,.(({(......{({,,,...,)))........({{{{,,.((((((((..(((........)))...)))))},)).,,.},))}}..(((((((..((((.((((.....((({{{(....)))))).....)))).))))}))))))...{(((....)))),(((((,,,,..}}}}}......{{{{......}}|}.......|.,.....)))|,,|}}}...))))}}.......{((({{((((((((,....}}{(((((({,,...,|}}}|||(({,......|}|}}||,{.|,..||}}}},,.....},})))))).....))))))))))}((({{..,,|{{{{{((({..{((({..,{(({....|}},,{|{{|}||{|||,,.,}}}}.},}}}}}),,.||}|||||,,....}}},((((((.......)))))).},,}}},,........,||{.,,,|||}}}})))}},)})))((((((((((((({{(.......)){(((((.(((({...})))).))))),.}}})},....,})))))))).,)))))))))).))))))..)))))))))),,.))})),,)}}.}.))).)))))),.))))..)))},{.,,,..,{{(.(((.((((({{((((..(.{{.(((((.{((((((......((((((.........||{,,.,{,.{{{||,.,,,..)}}}}.....)))))).....(((((..........)))))..))))))}....)))))..}})..)))))))))).)))}}|{{||..,))))})))))}....))))))))))))),}))},.))))))).)}|((((.(({...))).)))},|,{{(((((((((....((((.((((.((((((.((((((........{{({{{{{{((((.,,...|,}}}}..}))))).}..,|.,,,.,|{((((((((,,((,((((((...}))))).....,,|,|}|}|,....{{....||..{{||},.||.,(((((((((((.(((.({........(((((((((....(((((.(((.(((((,.,((.((({{(...({{{{{{(((,,,{{{{{.|{,..,,,}}|,,)))}}.,}}|||{|||{(((((((({...,))))))))|({(({...,.}|||||(((.((((((.,{((,...))},},(((((((((((((...(((((((((((((((({{...,}.)))))))(((((.(((...((({.(((((((((((,{.(((((((...(((,,((.(.(((((....{{{....))}))))).).)))))}((((.(.((....))}))))))))))).,}.)))))).((({..({,,((((((,.{{||,.|||||,||(.({(((((....,,.(((((.......))))),|(((..,,{.||||||}|||}..}}}.}}|((((((((......(((((((..((....)}))))))).}}..)))},)))),|||{||{||||.,,,}))),,}}}}|}}(({.......}},..,..}})}..))))))),.))))..))))).}))).)))..)))))((((((.((((.....))))....))))))..)))))))))......((((((((.((({..,({(.,((,..{(((((...(((({(((.(((((((((,,((....))))))))))))....((({{....{{{{{{||||.,||{{||{{((((((,{,(({{,,{{,,.||,,,|,|,,}}}||||.,|,.{{({..||||}.}}}}.},.}}|||||||}}|||,.}}}}}.,,,}.,||||,,,|.,|||||||,|||||.||||,,,||....{{.{{{{{{,{{,,.....|})))|}||)))|,)}|)))))))).)))}.)).,})))))))).)))))))){{{,...||||}}|||,|,...(({{{{{,({(({{....}},.|,,|...(((((((....))))))).}},,,})),))))))})))))..)))))))).)))))).)))}.||||{{(({((...)))}})))...,,||{((.{{,.,,,,,,}}||}((((({.(((((,.((((.,..(({{.((({.{......}.))))..}))),...)))).}},..}))).})))))))}),))))})}.,}.,,},))).))).)))))))).)))...))))))))))))))}}.))).))))))))))),{|.,||...}))))),(((((..((.((((((((.(((((((....((...(((((((((((..,......}..))))}..,))))))...))...))))))).)),((..(((((...)))))..)),.....)))))).))..))))),.})))))))}.,.)))))).).))))))))).))))....))).)))))}...}))},.)))))))..)))))))))))))))))((((((.{((({,,,(({.((((.((((((.{{((((((.{.{{.(((({(...((((......)))),,},..,),)}..}},.)))))).}}.))))))))))..|||{{{||||(,((,..(((,,,||.{(((,.((({......,,||||,,||||{|{{,,}}|.|}}}||||}}},.}.,,.||||||||||,..(((((...(((......)))...)))))...}}))}},}}},{{|.{.{{....)).}.}||.{(((({.(((((((((.((...({,{{{....}}),}.))..)).))))))))).}...))))),)),,...,,,.)))))),)))|((((((((((((((.{{{((((,(((((((((((......)}}))))).)))|((((((((((((((..(((((((((((....(((((((.((((((....((((((.{((({(({(({((,({{{{|||,||||{,||({(({({{((((({({{((((,,,,,,,.}}||..{{||||,}|}.}|||}}|||,||}|||}}.})),,,||(((((((((((((..(((((.((((((((....((.(((((.{{((((...))))},.}.))))).))..((((((((((((.((......(((........))).,.}.)).),})))},))))))(((((((((((.(((...(((((.(((((((((,((((((.,...{{{..(({,((((.,(((((({...|)))))),|,...}}|||,|,,,{,((((((((((,,,((((((((,.,{|,,{{{..(((..,,..(((((.........)))))..}..))).{{|||{{,,..{{(((,.,,,.})}}}||}}}}|.,||,,||.,{{{}.,||{|}||}.,.}}...|)))}}},}......,))}})))}}}},,)})}))))},,},{{|||||||...((((((...((((((((((......))))))....))))...)))))).|||,.....|}|||}.....{{|||....,,.,}}}.,,},,}}))}}}.,))),.,})))}}}........))))))))).}}........}))...))).))))),,))))).......)))))))).,((.((((({............,..|{{{{|,{||{{{{,{{{{...,,,,}.))}))}}})))))).))|(((((.......)))))})))))...)))))))..{{{{||,,}..(((((((.({..((.(((.((((((({.{{{{{(....,.....,{,{.,{..,(((({{.,....(((.(((.........{,.(((((((......)}})))))..},..(((.(((((..(({....}))(((((((.....(((((.((({......((((.((.....,)}))))(((((((({((((....{,....||.((((......))))....|{..,...,......))})...}))))))))}))).)))))))))))).....((((....))))))))).)))..(((((.((((((((((......)))).)))).)).)))))))).)))....,)}))}))..}}.)))))),,........))))))).)))...))....)).)))))))..{.,,||}|||,,..,,},,,}}||.{{,..,,.....)}).}}||}}}..,||},,|{|||,........,,.,}|,,,|||{..,|||||{|}}})))),,|||{|||,,,,,..))))))),..,)))))))},..,..)))))).....((.{.(((...)))})))))))).)))))))((((((.{,.........,.},..))))))((((((((((,....,.))))))).})).,{((({...,}})}((|...,,.((((((((....((((,(,,,.....{||.....)))..,{,....|}}|,},(((......))).,}}}}....}},}......))))))))......))).....)))).)))))))..)).)))))),.....}))))),,,((,,..,,}}|((((..(((((((.(((((...(((({{...}}},)))..))))).))))).))...))))|{{{..{(((({{,.,({(....))),,,,.,,}.}).,}}}}...}}))...,{{.....,||.(((........))).,,((((.((((((((......)))))))).))))...,{...((((((((..(({...((((((.(((((((((((((((......))))........,{......,,,..,,...........((((((((({{((.,.,((|...||..,,)}....((((.{,...|}.)))}.....(((((,(({,..,(({....,,..,,}}}...,))}.,,}}},|,............{{{......}},......,}}.,..,.....{||.......,))).....{{{{.(((....))),||||(((({...,|.{{{{(((,,....,{({(({{,,.||||},.,))))))}.),.))})).........))))).}}}))},,..{{{......,,}.,.,,,,......,...,,.,,))))))))..........))))).)))))).))))))...}),,))))))))})))))........)))))))))))))),....

Transcripts

ID Sequence Length GC content
NM_002291.3 NCBI
CUUCUUUGGGCUCGGGGGCUCCCGGAGCAGGGCGAGAGCUCGCGUCGCC… 5650 nt 0.4940
Summary

Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 1. The beta 1 chain has 7 structurally distinct domains which it shares with other beta chain isomers. The C-terminal helical region containing domains I and II are separated by domain alpha, domains III and V contain several EGF-like repeats, and domains IV and VI have a globular conformation. Laminin, beta 1 is expressed in most tissues that produce basement membranes, and is one of the 3 chains constituting laminin 1, the first laminin isolated from Engelbreth-Holm-Swarm (EHS) tumor. A sequence in the beta 1 chain that is involved in cell attachment, chemotaxis, and binding to the laminin receptor was identified and shown to have the capacity to inhibit metastasis. [provided by RefSeq, Aug 2011]

Forensic Context

A study in human skin demonstrated that the LAMB1 was significantly up-regulated in thermally injured tissue compared to normal skin, as part of a broad analysis of temporal gene expression during wound repair [Greco et al. DOI:10.1016/j.burns.2009.06.211]. A separate study in human abdominal subcutaneous adipose tissue found that the LAMB1 was up-regulated in response to a short-term overfeeding intervention [Shea et al. DOI:10.3945/ajcn.2008.25970].