Basic Information

Symbol
LAMB2
RNA class
mRNA
Alias
Laminin Subunit Beta 2 NPHS5 LAMS Laminin, Beta 2 (Laminin S) Laminin Subunit Beta-2 S-Laminin Subunit Beta Laminin B1s Chain S-LAM Beta Laminin S Laminin-11 Subunit Beta Laminin-14 Subunit Beta Laminin-15 Subunit Beta Laminin-3 Subunit Beta Laminin-4 Subunit Beta Laminin-7 Subunit Beta Laminin-9 Subunit Beta PIERS
Location (GRCh38)
3:49121113-49133118
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Drug abuse diagnoses
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_002292.4
Sequence length
5692.0 nt
GC content
0.6030

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2429.70 kcal/mol
Thermodynamic ensemble
Free energy: -2523.08 kcal/mol
Frequency: 0.0000
Diversity: 1289.17
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((...((((....))))...)))....((.(((.(((((((.......((((..((.....))((((((........)))))).....((((..(((((((.......((....)).....((((.((((((..(((........)))..).)))))))))....((((.((((((.((((.......))))((((........)))))))))))))).))))))).))))........((((((((.(((((.....((((((((((((.((((((....)))(((((((.(((((((..(((((((((((((((((((.(((..(((((((((((...)))).))))))).((..(((.((((((((((((........((.(.((((.....)))).).)).......)))..)))))))...)))))..))......))))))))))))).)).....((....)).(((((...)))))........))))))).))))))).......(((..((.((((((((((..(((((((.(((((((((((((((((((...(((((..((....))..))))).((((.((..(((((..(((((((........(((((......((((((((....((((...(((.(((.((((((((((((...))).))))).....)))).)))...)))..))))....(((((..(((((((.((((((((((((((((...)))))).....)))...))))))))).))))).)))))(((((.(((((......))))).)))))..(((.((....)).))))))))))).....)))))((((.................))))........)))))).)..)))))..)).))))....(((((........)))))..)))))).).)))).)).((((((((.....)).)))))).(((((.((((((.((((.........((((((((((((((((.((((((....(((((((........))))))).((((........))))((.(((......))))))))))).))))..))))))))))))..(((((((((((.................(((((......))))).((((.((((.(((....))).))))))))..((((((((((((....((((((((.(((..........((((((..(((....((((....))))..)))..)))))))))))))))))((((((..((.((.((...)).)))).))))))((((.(((........))).)))))))))))))))).)))))))))))))))....)))))).)))))..........(((((....)).))))))))).))))))).((((..(((((.(((((((((.((.((.(((....)))..)).))..)))))).......((((.(((.(((((((...))))))).))).))))........(((((.(((...(((((((.....(.(((.((((((..((((((((...((.((.(((.(((.(((((((.((((((.((((..(((.....)))..).))).))))((((..(((.....)))..)))).(((((...(((((.(((((..((((((((...))))))))(((((.((..((((((((..(((((((((((((((((((((..(((((((((((.(((((((.(((.......))).))))))))))..(..(((((((((((.((..((((..(((....)))..))))..)).)))))...)))).))..)...)))))))).......((((......))))..((((.(.((.((((...)))).)).).))))..((((.((((((((((((.((...)).)))))))))....))).)))).....((((...)))).))))))))))))).....(((((((((...((((.((((((((((((((((((((((((((((...))).)))).......((((((((((.((((...((..((((.(((((.((..((.(((((((....)))..)))).))..)).)))))))))((((((((.((.((((((((((((((...))))))..(((((....))))).(((((.((((((......)))(((((....(.((((((((...((((((((((........)).......(((.((((........)))).))))))))))))))))))))...)))))))).)))))...((((.(((((((((((......((.((((..(((((((((((((((.((((.((((((....))))))(((((((.(((....(((((((.((((((((((.((((.....((.......))...))))..))))))))))))))..(((........)))..)))..))))))))))(((((.(((((((((((.(((((((((((.(((((((((......((((((.((((.....))))))))))...((((((((..(((((.(((((((((..((..((((.((((......))))..)))).))..)))))....(((..(((((......(((....)))....(((((....)))))))))).))))))).))))).))))))))..((((........))))..(((((((..(.((.(((((....(((((((...((((.(((((.(.......)))))).))))..(((((...)))))((((..((((((((((.(((..((((..((((......))))...))))....((((((((((((((((((((........(((((((((.(((((((..(((((((..((.((((((((((((((.(((((((((.((....)).)))).)))..)))))))).(((.......)))....)))))))).)))))))))((........)).....((((.......((((((((.((((((((..(((.(((((.........(((((.((((.((...)))))))))))(((((((..((.((((((.....((((....))))........(((((((((.(((..((((.(((((...)))))..))))..)))))(((.....)))((((.(((.....))).))))......))))))).)))))).))..))))))).....((((((.((.....)).))))))))))).)))(((.......)))))))..)))).)))))))).....))))...))))))).))))))))).((.((((((((..(.((((((((.(((((...))))))))(((((((..((.((((((..((((((((.((((((((...(((.....))).....)).)))))).))))))))...)))))).))(((((..((((((((((((...)))))...((......))....((.((((((...)))))).))..))).))))..)))))....(((((........))))).....))))))).((((((((.(((((((..(((((((((..(((((.((.(((.........)))...)).)))))....))))))).))..))).)))).))))))))......((.((((((((....))))))))))(((((....((((((...))))))...)))))(((((.((....))...))))).))))).)..)))))))).))...))))))))))......((((((........))))))..(((((((.((((..(((((((((((((((.....((((....))))(((((...((((((..((((((...(((((.(((((((...))))))))).))).)))))).((((((((.((...))..))))))))....(((..(((((((.((((.((((((((((((.((((((....).)))))((((...((((((..((....(((((.(....................).)))))...))))))))...))))...))))).).)))))).)))).)))))))..)))....((((........)))).............)))))).))))).......)))))))))))))))...(((((.(((.((.((((........)))).....)))))..)))))...........))))..))))))))))))))))).((((((.(.(((.....))).).))))))..((((.....))))....))).))))))))))...))))))))))))))))))..)..))))))).(((((((((..((((..............).))))).)))))))((((.((((......))))))))(((((....))))))))))))))..)))..)))))))).)))))))....)))))))))...))))..)).)))))))))))))..))))))....)))...)))))))).))))...)))))))).(((((.((((...((((.((.((.((((....)))).)).))..)))))))))).))))).)))))))).)).)))).)))))))))).(((.....(((((((...(((....))))))))))......)))...))))).)))))))))))))...((((.....))))........((((((.....)))))))))))))))))).))))........))))))))..))))).....)))..)))))))((.((((((((.(((...(((.((((((...))))))..((((((.(((.(((.(((.....(((........)))..))).))).))).))))))....(((.(((((((((..((((...))))..)..)))))))).))).)))))).)))))))).))................).)))))))))...)))))..)).)))))))))).))).))))...)))))))).))))))))).))))))))))).)).)))))).))))).))))..(((((((...)))))))...........))))))))))))..)))((((.((.((((....(((((((........)).))))))))).))))))............)))))))....))).)))))))).....))))........)))))..)).))))))((((..(((((((.((((((((....)))...))))).)))))))))))..((((....))))..((((((.((((.((.(((((((...((((((..(((.(.(((.(((.((((((..((((((.(((...(((((.(((.(((((....((((((((((......))).))))))))))))............(((...)))......((.(((((((((.........((((...))))..((((((((.(((..(((.((((...)))))))..))).))))))))((((((...........)))))))))))).))))).)))..))))).))))))))....)..))))))....))).)))).)))..))))))...).)).)))))).)))))))))))))).....)))))).)..))))).
Thermodynamic Ensemble Prediction
(((...((((....)))).,.)))....((.(({.(((((((......{((((.{(({,....,((((((........))))))..,{.((((..((((((({((....{{..,,||.....,{((.((({((,,(({...,,,,.))},,}.)))|||||}.{((((,(({((((,.((((.......)))).....}))).}},))))))))),))),})))))).))))..,},{,,((((((,,{(((((...({((((((((((((.((((((....)))(((((((,({..{{{{{.(({,,{(((((((({(((.(((..(((((((((((...)))).))))))).,,}}|,,.{,,.(((((((({..........{.((((.....)))).,.{(((({.{{{,...,,)))|((((((((({{{|,,..{,|,,,}))},))))},,|.,.{((.((((...((((((..|||{{........(((((.(({,.(((((..,,..((((((((,,{(((.((.,....}.)))))).))))))))...,,,.{.{((((..((....))..))))),},.)))))..))),))))).}}|||..(((((((((......((((((((....((((...(((.(((.((((((((((((...}}).))))).....)))).)))...)))}.))))....,{{{,,,(((((((.(((((((({(((((((...)))))).....))}..)))))))))).))))).)),}|(((((.(((((......))))).))))),.(((.((....)).))))))))))).....))))).)))}.(((((((((({{.{{{,,{,.,,.,.,{{,{{{{((,{{{({..,,,{|||,.,.{((({......,,)))}}..,}|}|,,||,,......(((((({(.....}}.}))}}).{|{(({(((((..((({.{{..{{..{(((((((((((((((.((((((.{,.(((((((........))))))).,((({(......))))||.(((......))))))))))).))))..)))))))))))),{(((,{{((((,...|},..,,,......,|||{,..,,.}}))|.((((.((((.(((....))).)))))))).,(((((((((((((.,.{(((((((.(((..,...{{.{{,{(((,{,(({{{.,,)))}}.},))|,,)}.|}}},,,))))))))))},{,{{{.,{{,{{,||..,)),)))),))))))|{|||{{|,,.})))}}},..}.))))))))}))))})))),)))))}))))..}})))))}.))))),.||......))..|,|,|}}|},||||,,,..)))).}.((((..(((((.(((((((((.((.({.(((....)))..)).))..)))))),,,....((((.(((.(((((((...))))))).))).)))).....,,,(((((.(((...(((((((.....{.(((.((((((..((((((((...((.((.(((.(((.(((((((.((((((.((((..{((...,,)}}.|}|}||.})))((((..(((.....)))..)))).(((((...(((({,((((,..((((((((...))))))))((......}}.(((((({,,(((((((((((((((((((((..(((((((((((.(((((((.(((,......))).)))))))))}..{,.{((((((((((.{(..((((..(({....)))..))))..)).)))))...)))).)}.,}...)))))))).,.....{{{{......})))..((((,(.((.(({,...}))).)),).))))..((((.((((((((((((.((...)).)))))))))....))).)))).....((({...}))).))))))))))))),.,.,(((((((({..,((((.((((((((((((((((((((((((((((...))).)))).....,.((((((((((.((((...((..((((.(((((.((..((.((({(((....}})..)))).))..)).)))))))))((((((((.((.((((((((((((((...))))))..(((((....))))).(((((.((((((......)))(((((....(.((((((((...((((((((((........}},....,.(((.((((........)))).)))}))))))))))))))),,..)))))))).)))))...((((.(((((((((((....,.((.((((..(((((((((((((((.((({.((((((....))))))(((((((.(((.,,,{{,((((.((((((((((.{((({....((.......))...))))..)))))))))))))),,||.,.||.,..,,,||))||,)))))))))}(((((.(((((((((((.(((((((({({.((((((({,|||||.{((({(,{{((,.,,,|||||||}||,,,((((((((..(((((.,{((((({{,{(({{{.{{,((((.,.,{{||||{{||||.|,.,,,..,...}}|||}|,|))}}}}..|||,,,{||,...{(((((....))))))}))}.}}})))),))))).)))))))).,{{|||.||||,.,,||,,(({((((..{....||||{,.,,|||((({...||{{.{((((.|,,.,,,,,))))).)))},,(((((...))))}{{{|..((((((((((.(((..(((((((.((....(((((..,.|{|...{.(((((((((({(((((((((.,......(((((((((.(((((((,.(((((((..,(.((((((((((((((.(((((((((.((....)).)))).)))..)))))))}.{{{.......}))...,)))))))).}}))))))){{........}}.....((((.......((((((((.((((((((..(((,(((((,,,{.....(((((.((((.{,...}})))))))))(((((((..((.((((((..,..((((....))))..,.....((((((({((((((,((((.(((((...)))))..)))}..||{{{(((.....,,)}}}))|}}....}))))))}....,,,))))))).)))))).))..)))))))..,,..{((((,|{.....})|)))}))))))}.}}}{{{.,,....))}))))}.)))).)))))))).....)))).,.))))))).))))))))).((.((((((((..(.((({,(({.(((((...))))))))(((((((..({.((((((..((((((((.((((((((...(((.....))).....)),}))))).))))))))...)))))).}}(((((..((((((((((((...))))}...{{......,}....((.((((((...)))))).)).,))))}}))..)))))....(((((........)))))..,,.))))))).((((((((.(((((((..(((((((((..(((((.((.(((.........)))...)).)))))....))))))).))..))},)))).)))))))).....,((.((((((((....))))))))))|{(((....((((({...})))))...)))}{(((((.{,....,)...)))))}}}))).}..)))))))).))...}))))))))}......((((((........))))))..(((((((.((((..(((((((((((((((.....(({{...,|}}|(((((...((((({..((((((...(((((.(((((((...)))))))))},)).)))))).((((((((.((...))..))))))))....(((..(((((((.((((.(((((({(((((.((((({....}.)))))((((...((((((..{{....(((((.{.{{.............,,..,.)))))...}}))))))...))))...))))).).)))))).)))).)))))))..)))....((((........)))).............,))))).))))).......)))))))))))))))...(((((.{{({,(,((({,....,..}}}}.....,}),),.)))))...........))))..))))))))))))))))).|,..,.}}...|..)))))..)}.))))))}((((.....))))....))).))))))))))...)))}})))))}}||}},}..,..)))))}}.(((((((((..((({..............).))))).)))))))(((,{((((......)))))))).......||,}),)))))))))},,))}..)))))))).)))))))....)))))))))},,})))..)),}))))))))))))..))))))....)))}..}))))))).))))...)))))))).(((((,({((..,(,{{.||.{{.((((....)))),||,||..,}},)))))).}}})).)))))))).)).)))).)))))))))),(((.....(((((((...(((....))))))))))......)))...})))),,))))))))))))....{{{.,,,.,,||.....},,{{{(((,....}})))))))))))))))).}}))........})))))),..,})}}||,...}){{({{(((((((({{(((((..(({.,((({,((.(((.(((((.{({((((...))})}}},}..))))).))).)))))))))..(((({{((.....)))))))..(((.(((((((((..((((...))))..)..)))))))).)))...)))))))))).)))))}))......}))))).}.)))))))))...)))))..)).)))))))))).))).))))...)))))))).))))))))).})))))))))).)).)))))).))))).))))..(((((((...)))))))}}.)))))))))).)))))).)))).))),|,}))))))))),.)))))).))))}}))).,))}}}})}))))))),.}..,,.....,)))))))....))).)))))))).....}}},.......,)}},)}}))})))))}{|||}.(((((((,((((((((....)))...)))})})))))))},)),,|{||,,..}))}..((((((.((((.((.(((((({,..((((({..(((.(.(((.(((.((((((..{(((((.(((.,.(((((.{((.(((((....((((((((((......))).))))))))))))....{,....}.|{{...,))......{(.(((((((((...,,....{,{{{{.}},},.{(((((((.(((..(((.((((...))))}))..))).)))))))}((((((..,.....,..)))))))))))).))))).)))..))))).))))))))....}..))))))....))).)))).)))..))))))...}.)).)))))).))))))))))}}),.....)))))).)..))))).

Transcripts

ID Sequence Length GC content
NM_002292.4 NCBI
GCUCAAAGUCGCUGGACUCUAAGCUGUCGGAGGGACCGCUGGACAGACC… 5692 nt 0.6030
Summary

Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 2. The beta 2 chain contains the 7 structural domains typical of beta chains of laminin, including the short alpha region. However, unlike beta 1 chain, beta 2 has a more restricted tissue distribution. It is enriched in the basement membrane of muscles at the neuromuscular junctions, kidney glomerulus and vascular smooth muscle. Transgenic mice in which the beta 2 chain gene was inactivated by homologous recombination, showed defects in the maturation of neuromuscular junctions and impairment of glomerular filtration. Alternative splicing involving a non consensus 5' splice site (gc) in the 5' UTR of this gene has been reported. It was suggested that inefficient splicing of this first intron, which does not change the protein sequence, results in a greater abundance of the unspliced form of the transcript than the spliced form. The full-length nature of the spliced transcript is not known. [provided by RefSeq, Aug 2011]

Forensic Context

A study in mice demonstrated that the LAMB2 was overexpressed in the ventral midbrain of a selectively bred low methamphetamine drinking line compared to a high drinking line, indicating its differential expression is associated with innate risk for methamphetamine intake in the absence of drug exposure [Hitzemann et al. DOI:10.3390/brainsci9070155].