Basic Information

Symbol
LAMC1
RNA class
mRNA
Alias
Laminin Subunit Gamma 1 Laminin B2 Chain LAMB2 Laminin, Gamma 1 (Formerly LAMB2) Laminin-10 Subunit Gamma Laminin-11 Subunit Gamma Laminin Subunit Gamma-1 S-Laminin Subunit Gamma Laminin-2 Subunit Gamma Laminin-3 Subunit Gamma Laminin-4 Subunit Gamma Laminin-6 Subunit Gamma Laminin-7 Subunit Gamma Laminin-8 Subunit Gamma Laminin-9 Subunit Gamma S-LAM Gamma Laminin-1 Subunit Gamma
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Wound age identification

MANE select

Transcript ID
NM_002293.4
Sequence length
7929.0 nt
GC content
0.4880

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2636.10 kcal/mol
Thermodynamic ensemble
Free energy: -2780.13 kcal/mol
Frequency: 0.0000
Diversity: 2151.91
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((...(((((((((((.(..(((((((((((((((.(((....(((((((.((((..(((((((.(((..((.(...((((.((((((((((((((((((.(((.((((.....((((((...((((..(((((.(((........(((((((((((((((.((.(((((((((((((.(((((((...((((((....))))))........((((((.(((...))).))))))(((((((.((.((......)).)))))))))..))).)))))).).))))))))))..........(((.(((.(.((((((...)))))).).)))))))).)))))))).((((......))))))))))).((.(((((((((((((((((((......))))))..((.((.(((.((((((..(((((.(((((......))))).)))))..))))))...))))))).......)).))))))))))).))...))).))))).))))...))))))...)))).))).))))).((((((....)))))).....))))).)))))))).))))).))..))))))))))....)))))))))))))))).))))))......((((((.........))))))(((...)))...(((.((((((.(.((((((((.((((((((((.......((((((((...((((....(((((..(((..(((....))).)))..))))).....))))..((..((((((((.((((........).)))(((((((..((((..(((((.........((((..((((((((((((((((.......((((((((.((....)).((((((.(((((..((((((((((.(((...........(((((((((.....))))).)))))))))))))).)))((.((...(.(((((((((((...))))..)))))))).)).))....(((((((...(((.(((((...)))))....(((....))).)))...)))))))........((((..((((((((((.......)))))))))).))))......(((((((.((((.(((((..(((((((((..........).)))))))).........)))))))))((((......)))).)).)))))....)))))))))))((((((...((....))..)))))).))))))))(((......(((((((((((((.....(((......))))))))))))).)))......)))(((((((...((....((((.((((((....).))))).))))...))............((((......)))))))))))))))))))))))))))...)))))))))....(((((.(((...)))))))).((((((..((((.....)))).))))))((((....(((((......))))))))).))))..)))))))))))))))..))...))))))))...(((((((.......)))))))....)))))..))))).))...))).))).).)))))).))).(((((.(((((((.((..((((((.(((.....)))))))))(((((.(((((((((((.......(((....((((((((........))))).)))..)))...((((((((((......((((((((.((....)).))))))))(((((..(((((((.(((((((((((((((((((.(((((.((((((((((..(((((((((((((((((((((((.....)))))))))...((((((((((................)))))..))))).)))))).))))).)))..)).))))))))......(((((((..((((((((((........)))....)))))))..))))))).(((.((.((((...(((....))))))).)).))).))))))))))....(((((((((((((((.(((((..((((((..(((((.(((((((...))))))).))))).)))).(((((....)))))((((.((.(((((.(((....))).))))))))))).(((((.(((((..(((.((.(((((..(((((((((..((((((.(((......(((....((((.(((...(((((((.((((.....(((((((...)))))))...........(((((......)))))....(((((((.(((((((.....((((((((....((((.(((((((...(((((....(((((.(((((.((((((((((((((......((((((((((.(((((.((((((..(((((.((..(((((((....(((..((((((((((((((((((..(((...))).......(((((......)))))(((((.(.((((....)))).).))))).......)))))).)))))))(((.(((((((..((....)))))).))).)))(((((((((((.......)))))).)))))....((.((......)).))))))))))....)))))))..)).)))))..(((.(((.((((..((((((.((((((((.((........)).((((.....)))).(((((...((((((((...(((((((.......((..((((........((((((.((......)).))))))..))))..)).......)))))))...))))))))))))).....(((.(.(((((.((((((((..(((((((...((((..((((......))))...(((((........(((((((.....((((.((((((.(.......(((((((...)))))))))))).)).)))))))))))....))))))))).))))))).))).))))))))))).))).)))))))).))))))..))))))).)))(((((((.........)))))))...........))))))...))))).....((.(((((((....))))..))).))(((((.(((.((.(......).)).))).))))).)))))))))).....)))).).))).))))....)))))).)))))))))))...))))))))))))))))))).....)))))))..)))..))))...(((((((.(((....)).).))))))).((((((((((((((((((((......)).))))))......)))))))))))).........)))).)))))))..))).)))))))......))).))))))....)))))).)))...)))))..)).))).....))))))))))((((.......))))))..)))))..))))).)))))))))).((((.(((((........).)))).)))).)).))))......)))))))).)))))))..))))).)))))))))).((((..((...((...((..((((((.(((...))).)))))).))...)).))..))))....)))))).))))).......)))))((..((((((.((.....)).))))))...))........(((..((.....))..))).....)).)).))))).))))).)))))))...).))))))))))).((((((((.....((((((((((.((((..((((((((.((...(((.(((..(((..(((..((((((((((((((((.((..((((((....(((.(((((((..((.......))..)))))))..)))...)))).)).(((((.(((...........))).)))))))))))).)))).).))))))..))).((((.((...(.(((...((((((.......))))))))).).)).))))((((((((((((..((((((((.....((((((((((..(((((((((.......((((((((.(((.((((((...((((.......(((.....)))......((((.(((((.(((((((((((...((((.(.(......).)))))...).))).))).))))))))).))))........(((((..(((((((((((((.(((((.((((((((((..(((((..(((....))).))))).......(((((.((.(((((((..(.......)..))))(((((..((((....))))..)))))(((((.(((((((..(((.....)))...((((........)).))..(((..((((((((((((((....(((.....))).....((((((((.((((.....((((....((((.(((...............((((((((..(..((((((((((((((..(((((((....((.(((((((((....(((....)))))))......(((.......))).......(.(((((....((((((((((..(((...((((((((((((((((...((((.((..((((........))))..)).)))).....).)))).)))))))))))......(((((((((......((((((...((....((((((....))))))...((((((((.....(((((((((...))))((((((......(((((.((((...(((((((........((((((..((((((((.((.((((((((((...((((.((((..(((((((........))))(((......((.......))......))))))....))))))))...))))))).))).))(((((....(((((((...((((....))))...))).....))))...))))).....(((............)))..............))))))))))))))...((.((((((((.(((((((((....(((..(((((((((((((((((.((((((.((.....(((....)))...)).))))))..(((((((.(((..((((.(.......((((.((.........))...)))).......).)))))))...((((((((.....))))))))((((((((((..((((((....))))))..)))))(((((........)))))(((((....((((........((((((...((.((((...(((.(...(((((.((((........))))..))))).).)))....)))).))...........(((((...))))).....))))))....))))...))))).)))))..(((((.((((((.(((.(((.(((((.(((((......(((.((((((((((....)))))))...(((((..(((....((((...))))..)))..)))))...((((.((.((.....)).))))))((((.....))))...((.((..((....))..)).)).))).)))......))))).))))).)))....)))..)))))).)))))(((((((((((((((.....))))))......((((....))))..............((((....(((..((((........)))).)))..)))))))))))))....)))))))))))))).))).....))))))).))).(((((((((..(.(..((((.(((....))).))))..).)...)))))))))...)))))))))...((.(((((((((((((((((((..(((...)))..))))))))))........))))))).))..)).(((((((...(((((....)))))...)))).))).(((.((((((((.((((((....))))))........(((((((((...(((((..........(((((.(((((.........((((((....))))))...((((.((((.((((((........)))).))...)))).))))((((((.((((...((.((........)).)).))))))))))..............((((((....(((((..(((.((.(((.......))).)).)))..)))))..))))))..)))))..)))))))))))))))))))...)))))))).)))...))))))))..)).)))))))...)))))))))..)))))))))))))))).)))..........))...)))))).....)))))))))((((((.......))))))(((((.((.(((.(((........)))...))))).)))))......(((((.......((((((((((....))))))))))........)))))....)))..))))))))))..))))).)))))).))..(((((((....)))))))(((((.(((....))).)))))......(((((((((((...((.((((((.......................((((((((.........)))))))))))))).))))))))))))).((((..((((...(.(((....))))...))))..))))..((((((((....)))))))))))))))...))))))).))))....(((((..((((..(((.(((....))).)))))))..)))))((((........)))).)))..)..))))))))....))).))))....))))..............))))))))))))(.(((((((((((......))))))))))).))))))).....))))))))......)))..............))))))).)))))(((((((((.((....)).)))..(((.((((((((((...(((((.((((((.((((((((((.....((.(((((((..(((((((((......))))).....))))..))))))).))))).)))))).....(((.....((((....((..((((((((((((((((((((((((((.((((((....(((.((((((..........)))))).))).((((((.....(((((((....(((.(.((((((((..((((((((...............))))))((((((.(((((((((.((((....(((........)))...)))).))).))))))))))))(((......))).......))..)))))))).).)))..)))))))))))))......((((((.(((((...(((...........))).))))).))))))(((....)))...))))).).))))....)))))))))))))....))))..)))))..)))))).......)))..).))).)))))))))))))))))).)))...((((((...)).))))))))))........)))..)))))))((((((((......)))))))).)))))))))).........))))).)))))))))))))))))))))))))))).)))...))))))..)).......))))))))).......))))))))))..((((((((...((((.........((......)).))))...)))))))).((..(((((((((((...((((.....))))...))).))))))))..)).))))))))..)))..((((((..(.((......)).)..))))))...))))))))))))..)))))))).)))).........))))..))))..)))))))))).......))))))))(((..((((....)))))))....(((((((........)))))))................(((.((((((((...)))))))))))......))).........
Thermodynamic Ensemble Prediction
,,,,{(((((,,,.}||}|,.,||,((((((((((((((.((.(((((((((((((((((..((.((((..((((({.{({((((.((((((((({{(({{,{(,....||(((.((((((((,({((,({(({,,,(,,.,,..((((((((((.((.(......}.)).))))))))))..||||...||||||}}}.)))},..,,.{{..{|||||,|{{,,,))},)))})),,)),,)})),.))))))).)))))))))}},))))))..))}.}))),|(((((((..((((.{......}))))..))))).))}.)))))).)))))))))))))).)))))))))))))))),{({{{{({({.|||}})))})),((((((......))))))..(((((.((((((((((..(((((.(((((......))))).)))))..))))))..{((((((((((.{((((...((((...))))...))))},,((((((((((((,(({{...,{{,((((.,.(((((((((({{{{(((,,,,{{({({({{(((,.((((((((.((((((|(({{(((((((((((((((.,.(((((((..{{.{{......((((((..,......))))))(((((((({...{{..(((((({,(((((((((.,,,,.,...........,...}}}}}}}||,|}...{((((..(((..(((....))).)))..))))).....))))}.},..)),}.)))))))).......,}}}....))))))).,((((.((((.((((((.((((.......(((((((((,.(((........))),.)))..}))))),{.((((((((.,((,((((,,.,,.........)))).)}|,||||}}},.}|||||{,.....,||||}},}})|||{{...,.,})}|,..,,...)))))))))),.,)))).))))...............)))))))))))))))..})))...{(((((((.{(({(((((.,{({....((((..((((((((((.......)))))))))).))))...,.)))}|}},.||,..||||,..,{,,{,|||,}}......,),,)))))))}{{{{...((((((..((((((.{((..|{,|.,,,,.......,,,.}},.))).)))))).)))))).}))}..,,,....{(({.{.(((......})),)|}}||{((((((,{((......)))})))))}|(({{(({,{...,,))})}}}...,}})))))).))).)))))..})},))...}}}},...,..,,},))))}}|..{{{{{{{{||{{,|(|((,.((((.((((((((.,,..{,....)).....)))).)))).)))).|}}.||(((((,,((({{...,}})).}}}))}{|||...,(((((......))))))}}|{({({..,,({{{{,{{|,,,..})).))))),},.)}}}|((((((.......)))))),||||}|}|||||||}}.,{,..,||..||,,.}|{{{|||||..,|||{((((((({(((((((((.{(((((((((.,((((((..{{......({{,{{,...,,..})}......}}.))))))..))).))))))}..,.((((.((({,((.{({,....}}}}(((((,,..,({(((((....)))))))..,)))))...)}}})),))))},...)))))))}((((((((((..(((((((((((((((((((((((.....)))))))))...{{{{({((((..,,,.,,........)))),.}))))).)))))),,))))}}))..))}),)))))).,{(((((((((((.((((((((((.((.{{({(((((((.((({{{((.((.(((.(((.((.((({..{(((....))))))).)).))).))).)).)))))))))))))).....(((.(((..{((.....}}}.))).})),,,}}}})).)))))))..}))).))))....)))))))||{((.(({({{{(.({({{{{{.|{{|{{|....)))))),.....,,.,,,.{(((....)))),{|{{{...,.|||||.{{{...,,,))).})))}},}}.)))},})))),))}}}.....(((((((...))))))).{((((.....(((((......))))).....)))))....,))))))))))}.)}))),,,,,})}.}}}})))))))))),..}))).}}))))))))..)}}))))),{{,,(((((({(,{|,,,.{||||,,.(((.((((((((((({(((((({.,(.(((,.((((((((((((((((((.,(({...,,,....,,,{((((......))))}(((((.(.((((....)))).).))))).......)))))).)))))))(((.(((((((..({....}})))).))).)))(((((((((((,.....})))))).)))))....{(.((......)).))))))).)}}}}}))))))}..,},,.))))))))))).)))..}}})||)),|,{{(,{,,,,,,)}}}..)))))))))))))))....})))){((.((((((((.(((.((((.......)))}..........((((((.((......)).))))))...((((...{{...})...))))((((.((((((.{,((((...(((.(.((((,,((((((((.,{((((((...((((.,((({,,,,.,||}}.,{(({{,......,,||{{{||,,,,,{{||,{{{{((.{,......(((((((...))))))),)}}),}),}}}}}}}|||}....,)))}}))).))))))).))}.)))))))))),,}})..((((({..{{,||||...(((((...)))))}}}}}}...))}}})).)))).,,))))))))))))})))))))).))}((((((((((((.({...}).))))}((((((((((((((((((((((..(({({((((((((......)))..}))))}}).).)}..)))))){(((((((...(((((.....))))))))))))){{(,{{...,}.))}}|,((((({(((......))}}..))))){{{||((,||..,.{,(({((((((((((({(({{(,,,,,,||,|}}}}),,.,,,))})))||||||.{{{,.|||||{(,,,||}}}|}},,...})}|,}}||||,{,.({.(((({....))))),))..,},||{{(((..,,..))))))}.,,.||{{{{,{,,,,|})}})),..,|..{(((((((((,........{(((.(((((........).)))).)))))))}}})))))...)).}}})),)}.}))),))))...,))))))){{((((((.((((((((((((.{((((((.(((...})).))))))..|{{{{|{{(((..((((((.{(((((((((.{(((,.{((,,{,{{,,,{,((((((.....))))))||,||{{|||,,,..{{({{{.{{,..|.,,,{{....}},.,,...}}}}})},},}})))))}..,.,|||}},|}}|.{((({{{{,{.,,,.((((((......)))))).((((((...(((((((.........(((((.((((((..(((((.{(({{((.((({{{.,,..{{({{{,..,........}}.,}})))))}}.}},,{||||,,..{((({.(((,,.,,,,,...|||.}}})),,}}}|...|)))}})||||...,,,.}}},.,},..,|||,.,.((((((.......)))))),},.))))})))))).,,....{((,,,,,{.|||||,.,|.....||||.,....,,}}.,.....}))}}......))))).})..)))))).......,{{|,...|||...|..((((.(({{{{(((((((((({...((((.(.(......).)))))..,}.}},,))).))))))))).))))..,.,|,|(((((..(((((((((((((.(((((.((((((((({..(((((..(({....})).)))))........||||..{,{{,((((..,.......},.)}}|(((((..((((....))))..))))){((((.(((((({..{((....,|}}...{|{{........,,,||..,,|,,((((((((((((((....(((.....))).....((((((((.((((.....,,,,.,,.(({{.{{{...,.|,........{{((((,.,{({..{(((.((((((((((((((((({,,,((,(((({(((,...{(((....)))))))..,...,,{.......|||..,...,{.(((((....((((((((((..(((...((((((((((((((((...((((.((..((((........))))..)).)))).....).)))).)))))))))))......(((((((((......((((((...{{....((((((....)))))).,.{{((((((..,,{{({{{((({...,}}}((((({.,.,{,(((((,{(({...(((((((.,......((((((..((((((((....,,{.,{..((((((((.((.(((({..((((,{{{,,{{,|}|{.,,{.,,{{{,,,....{{,,....{.{{||..{{{||..{{{{{||,},,}}..}|.|.}}}}}},,}})))}||}..||||}..})))},,.}}}.......,..........})))).)))))).......))))...}}....,...))))))))))))))...({.((((((((.(((((((((....,{,..(((((((((((((((((.((((((.((....,(((....))).,.)).))))))..(((((((.,,...((((((,....,{((((,{{,..,,....)).|{||||.......,.},,,,}}...((((((((.....))))))))((({((((((..((((((....))))))..}}|||((((({,,...},))))){{{{{.,,{(,....,,,,,.,{{{{{...{{.{{{|||||||.|,,.(((((.((((........))))..))))),},}}}....}}}).})...........(((((...))))).....)))))}..,.}..,...))))).))))),.{((((.((((((.,{{.(((.(((((.(((((..,...(((.((((((((((....)))))))...(((((..(((....((((...))))..)))..))))){{,((((.((.((.....)).)))))){{{{.....))}}.,,}},{{...,.,,,.},.,,.,..))).)))......))))).))))).))).,,.,....)))))).))))|(((((((((((((((.....)))))).,{...((((....)))).,.,,.........((((....(((..((((........)))).)))..})))))))))))),...)))))))))))))).))).....))))))).}},.(((((((((..{.{..((((.(((....})).))))..).)...)))))))))...)))))))))...,,.{,(((((((((((((((((..(({...}))..))))))))}},.......,}))))),))},)),{{(((((...(((((....)))))...))))},}}.(((.((((((((.((((((....))))))........(((((((((...(((((........,,(((((.(({,{.........,{((((,,.,))}})}...{{{{.{{{{.,{{(((,...,{{{||||.,,...,,))}))))|,,|||,,((({{{{(......{{{{{,|{|..,)),,)))))..............((((((..,{,{(((..(((.{{,(((......}))).,,.)))..)))))..)))))).})))))},}))))))))))))))))))...)))))))).)))...))))))))..))})))))))...))))))}))}.)))))))))},)))))}.}}..........,,...)))))).....)))))))))((((((.......))))))(((((.((.(((.{((.,......))}...))))).)))))......(((((.......((((((((((....))))))))))........)))))....)))..))))))))))..))))).}))))).)).,{((((({....})))))}(((((.(((....))).)))))......(((((((((({..{((.((((((.......................((((((((.........)))))))))))))).))))))))))))).((((..((((...(.(((....))))...))))..))))..((((((((....)))))))),,,..,}))))))))}))).{.{{,.(((((..((((..,{{.(((....))).}},))))..))))).,)).,......))))))..)))))))}})))}....|}}.})}}....}))}..,,,,........)))))))))))),.(((((((((((......))))))))))).,)))))).....))))))))......,................))))))).))))},{{{{{((({((,,..,}.|||..(((.((((((((((...(((((.((((((.{(((((((((({..,,,,(({(({,..{,,((((((......)))))}....}}}).,,}))),)}))))).)))))).....{{{.,,.,((((|...,{..((((({((((((((((((((((((((.(({(({.,,{({{.((((((.......,..)))))).})).,{{{{|.....(((((((.,,.{((.{.((((((((..((((((((....,{,...,}}..))))))((((((.((((({(((,(({(....{{{......,.}}}..,)))).))}.}))))))))))}(((......))).......))..)))))))).}.)))..)))))))|||},,...}}}{(((((.(((((...(((...........))).))))).)))))}(((....))}...})))).).)))}...,))))))))))))}....))),..)))))..})))))....,..))}..}.)))}}))))))))))))))))).))).,,{,||{,...||,}|||}|||||,...})}}))}}}}.})}}|((((((((......))))))))}}))))))))).........))))).)))))))))))))))))),|||,|,}})}||{{{,,{{{.{{,|,|{{{((((((({....)))))))},)))))))),)}}}|,|}}}}.......,......||....||}||},,....,,,,}|||.((..(((((((((((...((((.....))))...))))))))))))..)),))},.)))))))))}((((((..{.,{......}}.,..))))))..........))))))..)))...}},)).)))).....}.)),,))).)))))))))),,.)}}}..)))).)))))))))))).))))))),,,..,,(((((((........))))))),,},{{{{....,,,,|((.((((((((...}))))))))))........,.,)))....

Transcripts

ID Sequence Length GC content
GCACUCGGGCACGCGCUCGGAAGUCGGGGGUCGGCGCGGAGUGCAGGCU… 7929 nt 0.4880
Summary

Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]

Forensic Context

A study in mice demonstrated that the LAMC1 was overexpressed in the ventral midbrain of a line selectively bred for low voluntary methamphetamine intake compared to a high-intake line, identifying it as an extracellular matrix gene with differential expression linked to addiction risk [Hitzemann et al. DOI:10.3390/brainsci9070155]. In human patients with second-degree burns, treatment with an artificial skin membrane was associated with improved wound healing outcomes, including reduced fibrosis and inflammation [Li et al. DOI:10.1002/jcla.24564].