Basic Information

Symbol
LAMC3
RNA class
mRNA
Alias
Laminin Subunit Gamma 3 Laminin-12 Subunit Gamma Laminin-14 Subunit Gamma Laminin-15 Subunit Gamma Laminin Subunit Gamma-3 Laminin, Gamma 3 DKFZp434E202 OCCM
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_006059.4
Sequence length
7455.0 nt
GC content
0.6247

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3285.90 kcal/mol
Thermodynamic ensemble
Free energy: -3406.34 kcal/mol
Frequency: 0.0000
Diversity: 1635.68
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((..((((((((((.(((((((..((.((((.........)))).))))))))))))))))))((.((((((((..(((((((((((((((..((((((((....((.((((((.....))))).).)))))))).)))))))))).))))).........((((((((..((((.((.((..((.((((((...(.((((((.((((((..(.((((....)))).)..)))))))))))).).)))))).))....)).))))))..))))))))...))..)))))))))).)..)))((((((.((((.((((((((((((((.(((.(((.(((((((((((((..(..(((((((((((((((((((((.............((((..(((...(((((......)).)))...))).)))).(((.((((((((.(((((((((............)).)))))))))).)).))).)))..).))))))))(((((((.(((..((((...((((.((..((((...((......))......(((((((((((((((((((...((((((((((((.(((.((((((.(((.(((..........))).)))))).).))))).))))).).))).))))).))))))))((((...)))))))))))))..)))).)).))))...))).)..))))))))))(((((..(((((((((((......((((((.(((.(((.(...((((((.......((((((.....))))))(((((((((.((.((((((............(((((((((.(((..(((.(((((((((.((((...((((..(((((...(((.((.(.((((((..((.(.((((((((((((....((((((((............))))))))..)))))........)))))))...).))..)).)))))))))))))))..))))))))...)))))))))))).))).(((((((....)))).))).(((((((.((((....))))..)).)))))....((.((((...((.((((((((............)))))))).)).....)))))).(.(((((.(((.(.(((..((((........((((.(((.(..(((.......)))..)))).))))(((((....))))).))))..)))))))))))).)..))))).)))).(((.((((((.((((..((((..((((.(((((((((((..((.((((((..((.((((.(((((...))))))))).))))))))...))..)))).....((((((.....(((.((((((.(((....(((((((((((((((.(((((.......)))))..)))).(((..(((((....)))))..)))..........((((((((.............)))))))).(((.......)))...((((((....)))).)))))))))))))...))).))))))..))).....)))))))))))))))))...))))..)))).)))))))))...(((((((((.........))))))))).))))))))...)))))))))..))))))))))))).))))))..(((...))).((((........))))(((((((((...(((((..((((.((((((((.((((((......(((....)))((((((........))))))....((((((((.((((((((((((......)))))))))((((.(((((((((((...((((((..((((((...))))))..)))((((.((((....)))).))))(((((((((.((((((((((.(((((((((((.(((((((((((.(((((....(((((((((((.(((((((((.((((((((((((.((....(((((((((((((.(((((((((.(.((((((.((((.((((((.((((((((((((((((((((((((.((((((((((.((((((............(((.(((((((((((.....)))))))(((.((.((((((.....)))))).))))))))).))))).))))(((((((...(((((((((.((....(((....))))))))).)))))((((((.......))))))(.((((((.((((.(((..........((((((..((((((((....(((.((((........)))))))...))))))))...........(((((((((((((((((.(((((((...((((.......))))....)))).).)).))).((((.((((((..((.(((......(((((((.((((.(((((.((...((((......(((((....((((((.(((((((((((((...))))...))))))((((((((........)))..)))))...).)).)))))).))))))))).)).))).)))))).))))))).......))).))..)))))).))))..(((((((..(((((((((..((((((...(((((....)))))..))))))..........(((......))).)).)))))))..))))))))))))))).)).))))..(((((((((..((..(((((((.((((((...(((((.((..(((((..(((.(((((......))))).))).....(((.((((............)))).))).))))).)).)))))....((((((.((((..((((((((((..(((((...((((((((....(((...((((((((((((.....)))(((((((((...)))))))))))))))(((((((...((((((((((..........((((((((((((.(.((((((.(((....))).)).)))))))))).(((((........)))))..(((((.(((((.(.(((...(..(((......((((.((((((((...................))))).)))))))....)))..)...))).).))))))))))(((........))).))))))))))))))))))))).))))))....))).))))))))......)))))..))).)).))))).)))))).))))...(..((((((((((((((.....((((((((.((((.((((((((((((.(((((.(((((((((.....))))..)))))))))).))))).)))....((((((.(((..(((((((.(((.(((((.(((....((.....))..)))..))))).))).)).)))...))....)))..))))))..)))).))))..(((((.((((((((((((((.((.(((((....((.((((((.(((.(((((.(((.((..((((.((((((...)))..)))))))...)))))...))))))))..(((((((((((.(((....((((((((((((((.................((((....((((...)))))))).(((((.(((((..(((((.....((.((((((.(((.(((((.....((((((((..((((((((.(((.(((((....(((((((.....))))).))..).))))(((.((.(((((......))).)).)).)))((((....(((((((((((.((((...((......))..))...((((((...(((.(((.(((......))).)))))))))))).(((((((((((..((((...))))..)))))))..)))).((.((((((........)))))).))...........)).))).))))))))...))))))).))))))))...)))))))).((((((((((..(..((((.((((...(((.(((((((.(..((((.....((((((...(.(((((.....(((((.(.(((((.(((((((.((((.((((((...)))))...).)))).))))((((((((((..((((.(((((......(((((((.((((.((((...)).)).)).)).))))))).(((.(.....))))(((.......)))))))).))))...........)).)).)))))).)))))))).))))))....))))))))))))((((((((((((.........))).....((((.((((.(((((.(((............)))))))).))))))))..((((((.......(((((......))))).....)))).)).(((((.(((..((.(((((......)))))....))..))))))))(((((.......)))))....)))))))))))))..).))).)))).))).)))))))).).))).))))))).)))))))).)))))).))...))))).....(((.(((..((((((((.(..(((((...(((((((((...(((....)))....)))))))))))))))))).))))).))).)))(((........))).((..((((.((((((((((((((((((.((((((((....))).(.(((((((..........))))))))(((((((((((((....(((...(.((((((((((...)))((((((((...............((.(((..(((.((((((((.(((((.....((((((..((((((((....)))).))))......))))))......(((.((((..(((.....))).))))))).(((((((........)))))))................))).)).))))).))))))...))).)))))))))).))))))).).)))......)))))))))))))(((((((..(((((..((((.(((.((((.((((((....)))).)).)))).))).))))..))))).(((((((..((((((((((((((((((...........)))).)).)))))..)))))))))))))).......(((((.(((((((((..(((((((.............(((((((((((......((((((.....)))).))......)))))).))))).....)))))))))))))...)))..))))).......((((((((...........))))))))...)))))))((((((.(((....))).))))))..((((((..((....))....)))))).......((((((.(((............)))))))))((((..((((((((..(((((.......))).)).)))))))).))))((.((....))))......)))))))))))))).))))))..))).))))..))...(((((((.....))).)))).(((((((((......)))))))))))))).))))).))))))))))))))(((.............)))(((...((((((((((.((((.......))))..))))))))))...))).((((((((((((...........(((((.(.(((......))).))))))...........))))))))))))....(((..(((((.(((((((.(((.(((((((.((...(((((((...)))))))........(((.......))).((((.....)))).)))))).)))...))))))))))...)))))..))).((((((.(......).))))))...))))))))))))))...)))))).))))))).)).))))))))..)))))).))))).((....)))))))))).......))))))))))))))..)...))))).).)))))))..))..))))..))))))))))).(((((..(((.((.(......).)).)))..)))))..))).)))))))))).)..(((((.......))))).....)))))))......(((.(((((((......))))))).))))))))))))).....)))))))))))))(((((((((....).))))))))...))))).....)))))).)))))).)))))))))).)))).....)))).))..).)))))))(((((.(((.........((((((((((((...(((.(((..(((((.......)))))....))).)))....))).)))))))))))).)))))...))))).)).)))))).)))))).(((.....))).....)))).)))))((((.(((..(((........))))))))))..)))))))))))..)))))((......)).))))))))..)))))))).))))))....((((.(((((((((((((.....(((..(((((.((((((((((((....))))((((((.((.((.(.((((((((((((((((.((.((.(((...((((((.......)))))).))))).))))))))....))).))))))).).)))).))))))..((((((.(((..(......)..)))...))))))...(((((((((.....)).((((((..((....((((........))))....))..))))))..(((((((...)))))))((((.(((........)))..)))))))))))))).))))))))))..))).))))))).))))))))))..........))))))).((((....................)))).))))))))...)))).))))))))))))))(((((((((.......)).)))))))..)))).((((...))))...........))).))))))))...((((((((((.((.(....((((.....))))..))).)))))..))))).....)))))))))...))))).).))).)))))....)))))))))......(((((((..(((((((((((((....((((.......(((.((((...(((((((((((.....((((..((((.(((((...........)))))))))....))))....)))))))))))((((.(.((....)).).)))).........)))).))))))).)))))))....)))))))))).)))(((((....))).)).)))))))))))..)))))..(((((.((((((.....((((......)))).....((.....))....))))))...)))))....))))))....))))))..)..))))))).((((......)))).((......)).......)))))).))).)))((((....))))........))))...))))))).)))............)))).))))))...
Thermodynamic Ensemble Prediction
..(((,,((((((((((.(((((((,.((.((((.........)))).))))))))))))))))))((,((((((((,,((({(((((((((((,{{{((((((....((,{((|||....,})))).,.}})))))).})))))))))||)))}||......,{||||((({(((((.,.})))}}|}|{||||...{.{(((((.((((((..{.((((....)))).}..)))))))))))}{|.||||}|{||,...||.,}}))},.)}))))))}).})}})})))))}}}.}..))}((((((.((((.((((((((((((((.{((.{{(,((((({(((((((..(..(((((((((((((((((((((.,...........((({..{{{..,({(((......))}.))...})).)}}}.(((.((((((((.((((((({{...,.,......)).)))))))))).)).))).)))..),}))))))}(((((((.(((..((((...((((.{{..((((...{{....,.})......((((((((((((((((({{...((((((((((((.(((.((((((.(((.({(,.........))).)))))).).))))).))))).).)))},)}}}.))))))))((({...}))))))))))))..)))).}}.))))...))).)..))))))))))(((((..(((((((((((...,,.((((((.{(({(((.,...((((((.......((((((.....)))))){((((((((.((.(((((({{,..{{.....,{{{{{||{.|||.,(,({(((((({((,(((({{.((((..{((((,.{{(({((.({((((({{,,,...((((((((.,,.}}}}||||||{|}}.}}}}.....|||,|}||,...}})}}.,}}}})),))))}.,|.||..||,}|||}|||||||||}.{||}}})))..})}})))))))})|)}}.(((((((....)))).))),{{||{{{||||,,,,,...,..,,{{{{||{((((,(((((.{.((.((((((((..,......,..)))))))).)).(((((.((.....))))))).}.))))}..))))}.......((((.(((.,..(((,....,.)))..}))).))))(((((....))))))))))).,,,,}}},,)))}}..}}}}}.}))),,||,||||||.,|||}}|||{,,((((,(({((((({,...{,.((((((..((.((((.(((((...))))))))).))))))))..|))},}}})}....((((({..,..{((,((((((.(({....((((((((((({(((.(({{{.......}||}|,,||},.(((..(((((....)))))..)))..,,,,...,{{((((((.,........}..))))))||{((,.....}}))}...((((({....)))).)))))))))))))...)}),))))))..})......}))))),,,}||||||}...}}}}..))))})))))))))...(((((((((,,...,},.))))))))}.})))))))...))))))))}..)))))),}}}))).))))))}}|,|}..,}}.((((.{,...,}))))((((((((({(,{(((,{{((((.,,,,,|||}||||||||..,{(((....,}}|||((...,}}}..,{{{{{{...((((((((.((((((((((((......))))))))),((({.,{{,{||||({((((((({..||{{||,,,))}}}|,.|||{((({{{{((((((({{,|||||{|,.,.|{{(((..(({.{.{((((((((,(,(((((((((((,{{{{(,.,,(((((((((({.((({((((({{(((({{({{{{.{{.{{.{,(((((((((((.(((((((((.(.((((({{((((.((((((.{(((((((((((((((((((((({.(((((((((({((,,.,,||},...,,{.(((.(((((((((((.....)))))))(((.((.((((((.....)))))).)}))))))).))),}})))|(((((((...(((((((((.((....(((....))))))))).)))))((((((.......)))))){.((((((.((((.,,........((..(((....((((((((.,..(,((((((........))))))}.,.))))))))....)))..))...,,..(((((((((((((((,(({{.,,,|}}}....,,||...,,|,,...,|{(((.(((((((.,....}}}}|}}.}}}}(((((((.((((.(((((.({,,{((({,,....{{|||,,,.{(((((.(({((((((((((...})),..}))))))((((({((........)))..)))))...}.)).)))))},|||}},)))})).))).)))))).)))))))...,..,|,|,,}..,))}},...,(((((,......))))).,,.((((((((..((({.,,(((((((.{..(((({{{...({((,{{,(({{..((((.....)))),.}))),{||...)))|,.)},|,|.,.((((((({({{((..(((((((.{(((((...(((((.((..((({{..{{{.{{(({.,,...})))).})),.,..(((.((((............)))).))),))))).)).))))),,{.((((((.((((..((((((((((..(((((...((((((((....(({...{||(((((((((.....)))(((((((((...)))))))))))))))(((((((...((((((((((..........((((((((((((.({((((((,(,,....)))}))})),,.))))).(((((........)))))..(((((.(((((.(.(((...(..(((......((((.((((((((..{,...........,,..))))).)))))))....)))..)...))).).))))))))))(((.....,,,}}}.))))))))))))))))))))).))),,,....}}}.))))))))......)))))..))).)).))))).)))))),}))).,.({.((((((((((((((..,..((((((((.((((.((((((((((((.(((({{(((((((((.....))))..)))))))))).))))).)))....((((((.(((..(((((((.(((.(((((.{{{..,,({.....})..))),.))))).))).))}}))..,),....)))..))))))..)))).)))){.(((((.((((((((((((((.((.(((((....{(.((((((.(((.(((((.(((.,{..((((.((((((...))),.}))))))...)})))...))))))))..(((((((((((.(((..,,((((((((((((({.......,......,..((((....((((...)))))))).(((((.(((((..(((((.....((.((((((.(((.(((((.....((((((((..((((((((.{((.((((,...{(,(((((.....))))).))..,.)))){((.((.(((((......))).)).)).))|((((....(((((((((((.(((,..,((.{{{{,,|..,.,,.|||||{|,.(((.(((.(((......))).))))))}}||||.(((({((((({,,({((,,,|||}.,}||||||..},,}.||,||||||,..,,,,.})))))})).}}}}.)}})})).))).))))))))...))))))).))))))))...)))))))).((((((((((..{..((((.((((...(((.(((((((.(..((((.....{(((((...(.(((((.....(((({{(.(((((.(((((((.((((.((((((...)))))...).)))).)))){(((((((((,.((((.(((((......(((((((.{(((,((((...)).)).)).)).))))))).(({,(.....))))(((.......)))))))).)))),..........}).)),}))))).)))))))).))))))....)))))))))))}((((((((({((.........}}}.....(((({((((.(((({,(((............)))))))).))))))))..((((((.......(((((......))))).....)))).)).(((((.(((..((.(((((......)))))....))..))))))))(((((.......))))).,,.)))))))))))))..).))).)))).))).)))))))).}.))).))))))).)))))))).)))))).))...))))).....({{.(((..((((((((.(..(((((...(((((((((.,.(((....))).,..))))))))))))))})))},)))).))).))|(((........))),((..((((.((((((((((((((((({,((((((((....))).{.(((((((.,........)))))}||((({{{((((((,....(((,,,{.((((({{{((,..|}}{{{{{{{{,,.......,...,,{|.|||,.,||,|{{((({{,{{{{(,(...((((((.,((((((((....))))))}))......))))))..,,,.(((.((((..(((.....))).))))))).(((((((........)))))))................})).)).}||||,||||||...}}},}|}})})}}}.}))))}).|,||},,..|||}|||}|||}}}}(((((((..(((((..((((.(((.((((.((((((....)))).)).)))).))).))))..))))).(((((((..{(((((((((((((((((...........)))).)).)))))..)))))))))))))).....,.(((((.(((((((((..(((((((............,(((((((((((......((((((|...})))).))......)))))).))))).....)))))))))))))...)))..))))).,.,,..((((((((...........))))))))...)))))))||||{|,|||,,,,})),)}))}}.,((((||.,((..,,||,...||}}}}.......|,||||||||....,,,.,,,,))))))))|((((..((((((((..({{{{.......},).)).}))))))).))))||.((....)))}......)))))))))))))).))))}),,))).))))..))...(((((((.....))).)))).(((((((((......)))))))))))))).))))).,)))))))))))))|,|...,{,......|),,{{(,,{((((((((((.((((.......))))..)))))))))),,.))).((((((((((((....,.,,,..(((((.(.(((......))).)))))).....,}.,..))))))))))))....(((..(((((.(((((((.((({(((((({{((...(((((({...}))))))..{{,...,,,....,,.,,},((((.....)))).}))))).))).},})))))))))...)))))..))).((((((.(......).))))))...))))))))))))))...)))))).))))))).)).))))))))..)))))).))))).||....,,))))))))....}..))))))))))))))}}}}..))))).).)))))))..)}}}))))..))))))))}))))..}.)))))))))}}..))))))))))))))))))))))).)))))))))).}..(((((.......})))}.....))))))),.....(((.(((((((......})))))).)))))))))))))..,..}))))))))))))(((((((((....}.))))))))...))))).....)))))).)))))).)))))))))),}))).....)))).))..}.)))))))))....{(((......}}|((((((((((({{.(((.(((..(((((.......)))))....))).)))},..))).)))))))),.))}))))))))),))))))})})))),)}))}).||}||{|,,||}.{{{|,||,.|}||((,({(,,...||}..,}}}.,,})})))))}.}))))))),))}})))))||}.,}.})).))))),}}..}}))))))})))))),,}}.(((((((((((.((((((.((((((...((((..{((((((((((.{(((.((((((((.((.((.(.(((((((((((((((({(({({,(((...((((((.......))))))})))))},,))))))....))).))))))).}.)))).)))))){(((((((....})).))))}....{(({.((((({...(((((((,,.....|,.{{{{{{.|{.....{(((,,,.....}}))....}}}))}}}||,,(((((((...}}||}}}{{{{.{||..,,}}}}))},,))))))))))))))))).)))).)).))))})))}})))))),}..))))....)))))).))))))}}}}}}}}}},.............||||{|||})))}|}}}}}..||,}}}))||||||(((((((((.,....,))})))))))}.,)))}||||,,.,))}...........))).))))))))...((((((((((.((.,....((((.....))))..))).)))))..})))).....,,,,}}}}}}}}))),,.,{|||.,,}))}...)))))))))...,..{{(((((..(((((((((((((....((((..,,,..{,,.{(((,..(((((((((((.....((((..(({{{(((((.........}.)))))))))....))))....))))))))))){{((.(.((....}}.},)))}.....,},,)},,.}),)))).))))))},..,))))))))))).))|{{((,...}}).},.)))))))))))..)))))..(((((.((((((.....((((......)))).....({.....))....))))))...)))))....)))))}....))))))..)..))))))).((((......)))).|..,,,,,})......,||}}}}.))),))}((((....))))........))))...))))))).)))............)))).))))))...

Transcripts

ID Sequence Length GC content
GAGCGGGGCCGGCAGAGCGCGCGGCGUCGGUGCCCUUGACCAUGGCGGC… 7455 nt 0.6247
Summary

Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]

Forensic Context

A study in humans demonstrated that the gene LAMC3 was overexpressed in menstrual blood-derived mesenchymal stem cells from women with endometriosis compared to controls, as identified through integrated transcriptomic and proteomic analysis [Penariol et al. DOI:10.3390/ijms231911515].