Basic Information

Symbol
LBP
RNA class
mRNA
Alias
Lipopolysaccharide Binding Protein Lipopolysaccharide-Binding Protein BPIFD2 BPI Fold Containing Family D, Member 2 LPS-Binding Protein
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_004139.5
Sequence length
1825.0 nt
GC content
0.5364

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-638.80 kcal/mol
Thermodynamic ensemble
Free energy: -670.98 kcal/mol
Frequency: 0.0000
Diversity: 443.13
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((..((.((((((..((((...(((((.....(((((((((((((((((((......((((..((((((((.((((....))))...((((..((((((...)))))).(((......))).(((((.....)))))........)))).))))))))))))...(((.(((((.(((((...(((((((((((.(((((....((.((((((((.......))))(((.((.((....)))).)))(((.(((((.(((...)))))))).)))..........))))))))))).)).))))))))))))))))))).))))))))))))))))(((((...........)))))..))))))(((((.(((((.(((((..(((.((..((((((((((((......(((((((...((((..(((...(((((((....)).....((((..(((((((..((((.....))))..)))))))((((((....(((((((((....((((.........))))...)))))))))...))).))).)))).((((((((((..((((...((((((.......(((....)))..(((((......)))))((((.(((((........)))))...((((((((((...(((.............((.(((.(((((..........))))).)))..))..)))..))))))))))...)))).))))))((((...))))..((((......))))..((((..(((....((((((....))))))..)))))))))))..))))))))))))))))))..)))).)))))))..))))))).........(((((.......)))))..(((((((((((.((.....(((((...)))))....(((.(((((..........))))).)))....)).)))))))).)))..)))))........)))))..)))))..)))))...)))))....)))))))))..))))))..))..)))((((((..(((((....)))))..(((((..((.((...((..(((((..((((((.(((((..((((..(((.(...........((((((((.......((.((....)).))(((((.....))))))))))))).((.((((.((((((((....)))...))))).)))))).......))))..))))..)))))...)))))).)))))..))....)).)).))))).....((((....))))...((((..((((((.....((((((..((.((((((((((....(((...............))).....)))).))))))..))..))))))......)))))))))).))))))..(((((......((((((....(..((.(((((((.....)))))))))..)....))))))......)))))((((((((......(.(((((...(((((.((((((((((..(((.....)))..)))))))))).(((......(((((((((((........)))).)))))))......)))..(((((((((((.......))))).))))))..)))))....))))).)(((.(((....))))))((((((((((((((((((((.....((..((((((....))))))..))..(((.((((..(((......((..(((...(((......)))..)))..))))).)))).))).)))))))).)))).)))))).)))))))))).....................
Thermodynamic Ensemble Prediction
(((((((...(((((((((((.(((({.,(({.(((((((((((((((((((,{{..{((((..,,,,,,|{,||||..}})}},...{,.,,,((((((...)))))),|{{.....,||}.{((((.....))))}}},....{||.{{|||,,,))))))}}.(((.(((((.(((((...(((((((((((.(((((,{,,{,.({{{{{{(.......,|||(({,{,.{|.}}}||{{,|,,,,,}|||||.{||..,})}}))||{|||{|........))))))))))).))}})))))))))))))))))).)))))))))))))))}(((((..,,...,,..)))))..))))))}))))))).)))}})))((((.((.(.{({..........}}}...).)).)))}.((((.((((({,{((((....(((.(((((((((((((((((..((((.....))))..))))))}((((((,,..(((((((((....((((.{......,))))..,))))))))),,.))).))).((((((((((((.((((((......((((((..((((({,..,.,...{{{(((...{{{|||||((((.(({{(,.......}})))...((((((((((...(((.............,,.(((.(((((..........))))).)))..,)..)))..))))))))))...{{{{...,,}}||,{{{.{(((..,,}|}|,|..|||||,(({{.,{{{,.{.((((({....)))))).}))}}}}})))))))))).}}.,,,,..((((.(((((.((((......((((..(({......(((({,......)))))...{({{{,{{{|.{|.....{({,({{{{||||.{{{.((,((((({,,,{..{..,,}|,.|||,...)),),}}}}}}.,,{,,||..,|..|,,,||(({{,.......})))....,||,...,,))),,,.))).))})))))}....,......{({.(((((....)))))..})}))}.)))).,....)))).)),,)).)))).,,)))))))))..))))))..,,.....||{(((((.((.....(((((((....((((((..(((..(((((.,....,.)))))...|{((.(((....))).))}|(((.{{.((((,.....((((........)))).,(((((....))))))))))..}.))))...((((,,..((((....)))),}.)))).})}.))))))..))}}))))....)).)))))...,,,))))))....)))))))))))).........})))))))))))))...))))}...{((((((((((.(((((((((...((....((((((((,..((.,{(((((.....)))))))}||,|,..{((((.,.{{......)).,,.))))}.....{.{((((...(((((.((((((((((..(((.....)))..)))))))))).(((......(((((((((((........)))).)))))))......)))..(((((((((((.......))))).))))))..})))),,,.))))).,.)),|}.)))).))))}}}}.))).))))))..))))))(((.(((({{(((....}}}))),,..,)))...)))...........}))})))))))}}}}.........)))).))).))))..,(((.(((|.,,}))))))),||{|{||||...........}}})))}},.......

Transcripts

ID Sequence Length GC content
GGGACAGUCCUGGCCCACUGCACUGGGAAUCUAGGAUGGGGGCCUUGGC… 1825 nt 0.5364
Summary

The protein encoded by this gene is involved in the acute-phase immunologic response to gram-negative bacterial infections. Gram-negative bacteria contain a glycolipid, lipopolysaccharide (LPS), on their outer cell wall. Together with bactericidal permeability-increasing protein (BPI), the encoded protein binds LPS and interacts with the CD14 receptor, probably playing a role in regulating LPS-dependent monocyte responses. Studies in mice suggest that the encoded protein is necessary for the rapid acute-phase response to LPS but not for the clearance of LPS from circulation. This protein is part of a family of structurally and functionally related proteins, including BPI, plasma cholesteryl ester transfer protein (CETP), and phospholipid transfer protein (PLTP). [provided by RefSeq, Apr 2012]

Forensic Context

A study in rats demonstrated that lipopolysaccharide binding protein (Lbp) mRNA was part of a core set of genes consistently upregulated in lung, kidney, and liver tissues within 24 hours following blast-related traumatic extremity injury, indicating its role in shared inflammatory pathways and bacterial sensing across both non-IRI and tIRI injury models [Rowe et al. DOI:10.3390/ijms26167794].