| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGACAGUCCUGGCCCACUGCACUGGGAAUCUAGGAUGGGGGCCUUGGC… | 1825 nt | 0.5364 |
The protein encoded by this gene is involved in the acute-phase immunologic response to gram-negative bacterial infections. Gram-negative bacteria contain a glycolipid, lipopolysaccharide (LPS), on their outer cell wall. Together with bactericidal permeability-increasing protein (BPI), the encoded protein binds LPS and interacts with the CD14 receptor, probably playing a role in regulating LPS-dependent monocyte responses. Studies in mice suggest that the encoded protein is necessary for the rapid acute-phase response to LPS but not for the clearance of LPS from circulation. This protein is part of a family of structurally and functionally related proteins, including BPI, plasma cholesteryl ester transfer protein (CETP), and phospholipid transfer protein (PLTP). [provided by RefSeq, Apr 2012]
A study in rats demonstrated that lipopolysaccharide binding protein (Lbp) mRNA was part of a core set of genes consistently upregulated in lung, kidney, and liver tissues within 24 hours following blast-related traumatic extremity injury, indicating its role in shared inflammatory pathways and bacterial sensing across both non-IRI and tIRI injury models [Rowe et al. DOI:10.3390/ijms26167794].